GGRNA | NM_001207026.1

LOCUS       NM_001207026            1703 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens POU class 2 homeobox 2 (POU2F2), transcript variant 3,
            mRNA.
ACCESSION   NM_001207026
VERSION     NM_001207026.1  GI:333360877
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1703)
  AUTHORS   Saglam,A. and Uner,A.H.
  TITLE     Immunohistochemical expression of Mum-1, Oct-2 and Bcl-6 in
            systemic anaplastic large cell lymphomas
  JOURNAL   Tumori 97 (5), 634-638 (2011)
   PUBMED   22158496
  REMARK    GeneRIF: Half of the cases displayed Oct-2 expression (15/30 cases)
            of systemic anaplastic large-cell lymphoma measured by tissue
            microarray immunohistochemistry.
REFERENCE   2  (bases 1 to 1703)
  AUTHORS   Herbeck,R., Teodorescu Brinzeu,D., Giubelan,M., Lazar,E., Dema,A.
            and Ionita,H.
  TITLE     B-cell transcription factors Pax-5, Oct-2, BOB.1, Bcl-6, and MUM1
            are useful markers for the diagnosis of nodular lymphocyte
            predominant Hodgkin lymphoma
  JOURNAL   Rom J Morphol Embryol 52 (1), 69-74 (2011)
   PUBMED   21424034
  REMARK    GeneRIF: Twenty-two cases of nodular lymphocyte predominant Hodgkin
            lymphoma were studied for the immunohistochemical expression of
            Pax-5, Oct-2, BOB.1, Bcl-6 protein and MUM1/IRF-4.
REFERENCE   3  (bases 1 to 1703)
  AUTHORS   Bailey,S.D., Xie,C., Do,R., Montpetit,A., Diaz,R., Mohan,V.,
            Keavney,B., Yusuf,S., Gerstein,H.C., Engert,J.C. and Anand,S.
  CONSRTM   DREAM investigators
  TITLE     Variation at the NFATC2 locus increases the risk of
            thiazolidinedione-induced edema in the Diabetes REduction
            Assessment with ramipril and rosiglitazone Medication (DREAM) study
  JOURNAL   Diabetes Care 33 (10), 2250-2253 (2010)
   PUBMED   20628086
  REMARK    GeneRIF: Observational study of gene-disease association,
            gene-environment interaction, and pharmacogenomic / toxicogenomic.
            (HuGE Navigator)
REFERENCE   4  (bases 1 to 1703)
  AUTHORS   Galetti,M., Alfieri,R.R., Cavazzoni,A., La Monica,S., Bonelli,M.,
            Fumarola,C., Mozzoni,P., De Palma,G., Andreoli,R., Mutti,A.,
            Mor,M., Tiseo,M., Ardizzoni,A. and Petronini,P.G.
  TITLE     Functional characterization of gefitinib uptake in non-small cell
            lung cancer cell lines
  JOURNAL   Biochem. Pharmacol. 80 (2), 179-187 (2010)
   PUBMED   20363215
  REMARK    GeneRIF: Gefitinib may exert an inhibitory effect on the
            intracellular accumulation of drugs transported by hOCT1 and hOCT2.
REFERENCE   5  (bases 1 to 1703)
  AUTHORS   Advani,A.S., Lim,K., Gibson,S., Shadman,M., Jin,T., Copelan,E.,
            Kalaycio,M., Sekeres,M.A., Sobecks,R. and Hsi,E.
  TITLE     OCT-2 expression and OCT-2/BOB.1 co-expression predict prognosis in
            patients with newly diagnosed acute myeloid leukemia
  JOURNAL   Leuk. Lymphoma 51 (4), 606-612 (2010)
   PUBMED   20141429
  REMARK    GeneRIF: OCT-2 may act as a cell survival factor in acute myeloid
            leukemia by mediating expression of downstream targets, such as
            BCL-2.
REFERENCE   6  (bases 1 to 1703)
  AUTHORS   Muller-Immergluck,M.M., Schaffner,W. and Matthias,P.
  TITLE     Transcription factor Oct-2A contains functionally redundant
            activating domains and works selectively from a promoter but not
            from a remote enhancer position in non-lymphoid (HeLa) cells
  JOURNAL   EMBO J. 9 (5), 1625-1634 (1990)
   PUBMED   2328728
REFERENCE   7  (bases 1 to 1703)
  AUTHORS   Scheidereit,C., Cromlish,J.A., Gerster,T., Kawakami,K.,
            Balmaceda,C.G., Currie,R.A. and Roeder,R.G.
  TITLE     A human lymphoid-specific transcription factor that activates
            immunoglobulin genes is a homoeobox protein
  JOURNAL   Nature 336 (6199), 551-557 (1988)
   PUBMED   2904654
REFERENCE   8  (bases 1 to 1703)
  AUTHORS   Muller,M.M., Ruppert,S., Schaffner,W. and Matthias,P.
  TITLE     A cloned octamer transcription factor stimulates transcription from
            lymphoid-specific promoters in non-B cells
  JOURNAL   Nature 336 (6199), 544-551 (1988)
   PUBMED   2904653
REFERENCE   9  (bases 1 to 1703)
  AUTHORS   Clerc,R.G., Corcoran,L.M., LeBowitz,J.H., Baltimore,D. and
            Sharp,P.A.
  TITLE     The B-cell-specific Oct-2 protein contains POU box- and homeo
            box-type domains
  JOURNAL   Genes Dev. 2 (12A), 1570-1581 (1988)
   PUBMED   3265124
REFERENCE   10 (bases 1 to 1703)
  AUTHORS   Ko,H.S., Fast,P., McBride,W. and Staudt,L.M.
  TITLE     A human protein specific for the immunoglobulin octamer DNA motif
            contains a functional homeobox domain
  JOURNAL   Cell 55 (1), 135-144 (1988)
   PUBMED   2901913
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from M36653.1 and AC022515.5.
            
            Summary: The protein encoded by this gene is a homeobox-containing
            transcription factor of the POU domain family. The encoded protein
            binds the octamer sequence 5'-ATTTGCAT-3', a common transcription
            factor binding site in immunoglobulin gene promoters. Several
            transcript variants encoding different isoforms have been found for
            this gene. [provided by RefSeq, Oct 2011].
            
            Transcript Variant: This variant (3) differs in the 3' UTR and
            coding sequence compared to variant 1. The resulting isoform (3) is
            shorter at the C-terminus compared to isoform 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: M36653.1, X53468.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025089, ERS025095 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1617              M36653.1           5-1621
            1618-1618           AC022515.5         1943-1943
            1619-1703           M36653.1           1622-1706
FEATURES             Location/Qualifiers
     source          1..1703
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="19"
                     /map="19q13.2"
     gene            1..1703
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /note="POU class 2 homeobox 2"
                     /db_xref="GeneID:5452"
                     /db_xref="HGNC:9213"
                     /db_xref="MIM:164176"
     exon            1..90
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    24..26
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /note="upstream in-frame stop codon"
     variation       complement(33)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371039226"
     variation       complement(61)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373375555"
     CDS             63..1466
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /note="isoform 3 is encoded by transcript variant 3; POU
                     domain, class 2, transcription factor 2; homeobox protein;
                     OTF-2; octamer-binding protein 2; octamer-binding
                     transcription factor 2; lymphoid-restricted immunoglobulin
                     octamer-binding protein NF-A2"
                     /codon_start=1
                     /product="POU domain, class 2, transcription factor 2
                     isoform 3"
                     /protein_id="NP_001193955.1"
                     /db_xref="GI:333360878"
                     /db_xref="CCDS:CCDS56094.1"
                     /db_xref="GeneID:5452"
                     /db_xref="HGNC:9213"
                     /db_xref="MIM:164176"
                     /translation="

MVHSSMGAPEIRMSKPLEAEKQGLDSPSEHTDTERNGPDTNHQNPQNKTSPFSVSPTGPSTKIKAEDPSGDSAPAAPLPPQPAQPHLPQAQLMLTGSQLAGDIQQLLQLQQLVLVPGHHLQPPAQFLLPQAQQSQPGLLPTPNLFQLPQQTQGALLTSQPRAGLPTQAVTRPTLPDPHLSHPQPPKCLEPPSHPEEPSDLEELEQFARTFKQRRIKLGFTQGDVGLAMGKLYGNDFSQTTISRFEALNLSFKNMCKLKPLLEKWLNDAETMSVDSSLPSPNQLSSPSLGFDGLPGRRRKKRTSIETNVRFALEKSFLANQKPTSEEILLIAEQLHMEKEVIRVWFCNRRQKEKRINPCSAAPMLPSPGKPASYSPHMVTPQGGAGTLPLSQASSSLSTTVTTLSSAVGTLHPSRTAGGGGGGGGAAPPLNSIPSVTPPPPATTNSTNPSPQGSHSAIGLSGLNPSTG

"
     misc_feature    645..869
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /note="Found in Pit-Oct-Unc transcription factors; Region:
                     POU; smart00352"
                     /db_xref="CDD:197673"
     misc_feature    954..1124
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(954..968,972..974,1023..1025,1041..1043,1080..1082,
                     1086..1091,1098..1103,1107..1115,1119..1124)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(960..962,969..971,1089..1091,1098..1103,1110..1112)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     misc_feature    1227..1292
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P09086.3);
                     Region: Leucine-zipper"
     variation       complement(83)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201035439"
     exon            91..156
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(103)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202021860"
     variation       complement(119)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145518520"
     variation       complement(135)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149684085"
     variation       complement(142)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140322079"
     variation       complement(143)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:373677672"
     exon            157..191
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /inference="alignment:Splign:1.39.8"
     exon            192..248
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(208)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372088467"
     variation       complement(231)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373198280"
     variation       complement(235)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147555913"
     exon            249..365
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(264)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113697394"
     variation       complement(265)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145313361"
     variation       complement(282)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369000179"
     variation       complement(339)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139761991"
     variation       complement(346)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150784596"
     variation       complement(363)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113689861"
     exon            366..471
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(425)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376769120"
     variation       complement(463)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141261459"
     exon            472..563
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(479)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148654132"
     variation       complement(482)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375042716"
     variation       complement(492)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200919726"
     variation       complement(526)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144295200"
     variation       complement(549)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142832761"
     exon            564..725
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(607)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371631003"
     variation       complement(616)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200544374"
     STS             617..856
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /standard_name="POU2F2"
                     /db_xref="UniSTS:253999"
     exon            726..867
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(812)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138243265"
     exon            868..1016
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(871)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373127616"
     variation       complement(899)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145633555"
     variation       complement(922)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369381206"
     variation       complement(927)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368762837"
     variation       complement(947)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375184543"
     variation       complement(962)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373724008"
     exon            1017..1193
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1047)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142293929"
     variation       complement(1073)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374063683"
     variation       complement(1097)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369799078"
     variation       complement(1142)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192872020"
     exon            1194..1260
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1213)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200445754"
     variation       complement(1220)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372373896"
     variation       complement(1226)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375995375"
     exon            1261..1703
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(1381)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185988799"
     variation       complement(1426)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377011370"
     variation       complement(1433)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372097777"
     variation       complement(1438..1439)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace=""
                     /replace="tt"
                     /db_xref="dbSNP:371927380"
     variation       complement(1439)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367613289"
     variation       complement(1477)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367932052"
     variation       complement(1504)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202163562"
     variation       complement(1505)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376651765"
     variation       complement(1627)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78816499"
     variation       complement(1654)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:181004153"
     variation       complement(1681)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371886208"
     variation       complement(1692)
                     /gene="POU2F2"
                     /gene_synonym="Oct-2; OCT2; OTF2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:142827647"
ORIGIN

ggcccccagagagggtggggagatgacacagttgttcccccagccctggcggggcgggcagcatggttcactccagcatgggggctccagaaataagaatgtctaagcccctggaggccgagaagcaaggtctggactccccatcagagcacacagacaccgaaagaaatggaccagacactaatcatcagaacccccaaaataagacctccccattctccgtgtccccaactggccccagtacaaagatcaaggctgaagaccccagtggcgattcagccccagcagcacccctgccccctcagccggcccagcctcatctgccccaggcccaactcatgttgacgggcagccagctagctggggacatacagcagctcctccagctccagcagctggtgcttgtgccaggccaccacctccagccacctgctcagttcctgctaccgcaggcccagcagagccagccaggcctgctaccgacaccaaatctattccagctacctcagcaaacccagggagctcttctgacctcccagccccgggccgggcttcccacacaggccgtgacccgccctacgctgcccgacccgcacctctcgcacccgcagccccccaaatgcttggagccaccatcccaccccgaggagcccagtgatctggaggagctggagcaattcgcccgcaccttcaagcaacgccgcatcaagctgggcttcacgcagggtgatgtgggcctggccatgggcaagctctacggcaacgacttcagccagacgaccatttcccgcttcgaggccctcaacctgagcttcaagaacatgtgcaaactcaagcccctcctggagaagtggctcaacgatgcagagactatgtctgtggactcaagcctgcccagccccaaccagctgagcagccccagcctgggtttcgacggcctgcccggccggagacgcaagaagaggaccagcatcgagacaaacgtccgcttcgccttagagaagagttttctagcgaaccagaagcctacctcagaggagatcctgctgatcgccgagcagctgcacatggagaaggaagtgatccgcgtctggttctgcaaccggcgccagaaggagaaacgcatcaacccctgcagtgcggcccccatgctgcccagcccagggaagccggccagctacagcccccatatggtcacaccccaagggggcgcggggaccttaccgttgtcccaagcttccagcagtctgagcacaacagttactaccttatcctcagctgtggggacgctccaccccagccggacagctggagggggtgggggcgggggcggggctgcgccccccctcaattccatcccctctgtcactcccccacccccggccaccaccaacagcacaaaccccagccctcaaggcagccactcggctatcggcttgtcaggcctgaaccccagcacggggtaagtgggtgcacgtgggaagctgtggggagaagcagggtcgctgctgcttctagggtggggagcggcaccccagttatgttggcaggtccctgcccctgctaatgcctctgctttgcctcttgcagaagcacaatggtggggttgagctccgggctgagtccagccctcatgagcaacaaccctttggccactatccaaggtgcgtgctgcctcatgtcacacccatcgtcaccagccc

//

Annotations: