2025-05-09 19:59:04, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001202546 2818 bp mRNA linear PRI 12-MAY-2013 DEFINITION Homo sapiens cut-like homeobox 1 (CUX1), transcript variant 7, mRNA. ACCESSION NM_001202546 VERSION NM_001202546.1 GI:321400115 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2818) AUTHORS Li,T., Wang,H., Sun,Y., Zhao,L., Gang,Y., Guo,X., Huang,R., Yang,Z., Pan,Y., Wu,K., Xu,L., Liu,Z. and Fan,D. TITLE Transcription factor CUTL1 is a negative regulator of drug resistance in gastric cancer JOURNAL J. Biol. Chem. 288 (6), 4135-4147 (2013) PUBMED 23255599 REMARK GeneRIF: overexpression of active CUTL1 significantly resulted in increased cancer tissue response to chemotherapy and therefore inhibited growth, whereas knockdown of CUTL1 conferred resistance to chemotherapy. REFERENCE 2 (bases 1 to 2818) AUTHORS McNerney,M.E., Brown,C.D., Wang,X., Bartom,E.T., Karmakar,S., Bandlamudi,C., Yu,S., Ko,J., Sandall,B.P., Stricker,T., Anastasi,J., Grossman,R.L., Cunningham,J.M., Le Beau,M.M. and White,K.P. TITLE CUX1 is a haploinsufficient tumor suppressor gene on chromosome 7 frequently inactivated in acute myeloid leukemia JOURNAL Blood 121 (6), 975-983 (2013) PUBMED 23212519 REMARK GeneRIF: Data indicate CUX1 as a conserved, haploinsufficient tumor suppressor frequently deleted in myeloid neoplasms. REFERENCE 3 (bases 1 to 2818) AUTHORS Liu,K.C., Lin,B.S., Zhao,M., Wang,K.Y. and Lan,X.P. TITLE Cutl1: a potential target for cancer therapy JOURNAL Cell. Signal. 25 (1), 349-354 (2013) PUBMED 23085261 REMARK GeneRIF: Cutl1 played transcriptional level mediated by signal transduction, translational level mediated by miR122, posttranslational level such as phosphorylation, de-phosphorylation, acetylation and proteolytic cleavage. Review article REFERENCE 4 (bases 1 to 2818) AUTHORS Sasayama,D., Hiraishi,A., Tatsumi,M., Kamijima,K., Ikeda,M., Umene-Nakano,W., Yoshimura,R., Nakamura,J., Iwata,N. and Kunugi,H. TITLE Possible association of CUX1 gene polymorphisms with antidepressant response in major depressive disorder JOURNAL Pharmacogenomics J. (2012) In press PUBMED 22584459 REMARK Publication Status: Available-Online prior to print REFERENCE 5 (bases 1 to 2818) AUTHORS Zhai,Z., Ha,N., Papagiannouli,F., Hamacher-Brady,A., Brady,N., Sorge,S., Bezdan,D. and Lohmann,I. TITLE Antagonistic regulation of apoptosis and differentiation by the Cut transcription factor represents a tumor-suppressing mechanism in Drosophila JOURNAL PLoS Genet. 8 (3), E1002582 (2012) PUBMED 22438831 REMARK GeneRIF: we find repression of apoptosis regulators by Cux1 in human cancer cells. REFERENCE 6 (bases 1 to 2818) AUTHORS Lievens,P.M., Tufarelli,C., Donady,J.J., Stagg,A. and Neufeld,E.J. TITLE CASP, a novel, highly conserved alternative-splicing product of the CDP/cut/cux gene, lacks cut-repeat and homeo DNA-binding domains, and interacts with full-length CDP in vitro JOURNAL Gene 197 (1-2), 73-81 (1997) PUBMED 9332351 REFERENCE 7 (bases 1 to 2818) AUTHORS Chernousov,M.A., Stahl,R.C. and Carey,D.J. TITLE Schwann cells secrete a novel collagen-like adhesive protein that binds N-syndecan JOURNAL J. Biol. Chem. 271 (23), 13844-13853 (1996) PUBMED 8662884 REFERENCE 8 (bases 1 to 2818) AUTHORS Scherer,S.W., Neufeld,E.J., Lievens,P.M., Orkin,S.H., Kim,J. and Tsui,L.C. TITLE Regional localization of the CCAAT displacement protein gene (CUTL1) to 7q22 by analysis of somatic cell hybrids JOURNAL Genomics 15 (3), 695-696 (1993) PUBMED 8468066 REFERENCE 9 (bases 1 to 2818) AUTHORS Neufeld,E.J., Skalnik,D.G., Lievens,P.M. and Orkin,S.H. TITLE Human CCAAT displacement protein is homologous to the Drosophila homeoprotein, cut JOURNAL Nat. Genet. 1 (1), 50-55 (1992) PUBMED 1301999 REFERENCE 10 (bases 1 to 2818) AUTHORS Ottolenghi,S., Mantovani,R., Nicolis,S., Ronchi,A. and Giglioni,B. TITLE DNA sequences regulating human globin gene transcription in nondeletional hereditary persistence of fetal hemoglobin JOURNAL Hemoglobin 13 (6), 523-541 (1989) PUBMED 2481658 REMARK Review article COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AK303151.1, L12579.1 and BC012323.1. Summary: The protein encoded by this gene is a member of the homeodomain family of DNA binding proteins. It may regulate gene expression, morphogenesis, and differentiation and it may also play a role in the cell cycle progession. Several alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Feb 2011]. Transcript Variant: This variant (7) lacks an in-frame exon in the 5' region and has an alternate 3' sequence including the coding region, as compared to variant 1. The resulting isoform (g) lacks an internal segment and has a shorter and distinct C-terminus, as compared to isoform d. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK303151.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025084 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-463 AK303151.1 5-467 464-773 L12579.1 571-880 774-1874 L12579.1 887-1987 1875-2818 BC012323.1 1983-2926 FEATURES Location/Qualifiers source 1..2818 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="7" /map="7q22.1" gene 1..2818 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /note="cut-like homeobox 1" /db_xref="GeneID:1523" /db_xref="HGNC:2557" /db_xref="MIM:116896" exon 1..86 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 6 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="g" /replace="t" /db_xref="dbSNP:373609751" CDS 24..1943 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /note="isoform g is encoded by transcript variant 7; golgi integral membrane protein 6; protein CASP; cut homolog; putative protein product of Nbla10317; homeobox protein cux-1; CCAAT displacement protein" /codon_start=1 /product="protein CASP isoform g" /protein_id="NP_001189475.1" /db_xref="GI:321400116" /db_xref="CCDS:CCDS59071.1" /db_xref="GeneID:1523" /db_xref="HGNC:2557" /db_xref="MIM:116896" /translation="
MAANVGSMFQYWKRFDLQQLQDLRKQVAPLLKSFQGEIDALSKRSKEAEAAFLNVYKRLIDVPDPVPALDLGQQLQLKVQRLHDIETENQKLRETLEEYNKEFAEVKNQEVTIKALKEKIREYEQTLKNQAETIALEKEQKLQNDFAEKERKLQETQMSTTSKLEEAEHKVQSLQTALEKTRTELFDLKTKYDEETTAKADEIEMIMTDLERANQRAEVAQREAETLREQLSSANHSLQLASQIQKAPDVAIEVLTRSSLEVELAAKEREIAQLVEDVQRLQASLTKLRENSASQISQLEQQLSAKNSTLKQLEEKLKGQADYEEVKKELNILKSMEFAPSEGAGTQDAAKPLEVLLLEKNRSLQSENAALRISNSDLSGRCAELQVRITEAVATATEQRELIARLEQDLSIIQSIQRPDAEGAAEHRLEKIPEPIKEATALFYGPAAPASGALPEGQVDSLLSIISSQRERFRARNQELEAENRLAQHTLQALQSELDSLRADNIKLFEKIKFLQSYPGRGSGSDDTELRYSSQYEERLDPFSSFSKRERQRKYLSLSPWDKATLSMGRLVLSNKMARTIGFFYTLFLHCLVFLVLYKLAWSESMERDCATFCAKKFADHLHKFHENDNGAAAGDLWQ
" misc_feature 1167..1847 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /note="CASP C terminal; Region: CASP_C; pfam08172" /db_xref="CDD:203868" variation 48 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:200925347" exon 87..134 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 106 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:143267032" variation 107 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:374397164" exon 135..213 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 193 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:367586602" variation 207 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:148322402" exon 214..351 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 283 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:201537465" variation 286 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="c" /db_xref="dbSNP:77240477" variation 339 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:371126154" exon 352..475 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 359 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:143157780" variation 374 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:201650660" variation 416 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:375357960" variation 417 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:138328289" variation 422 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="c" /db_xref="dbSNP:11540900" variation 429 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:199800281" exon 476..552 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 486 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:142863665" variation 488 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:201993734" variation 533 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:199535463" variation 543 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:150799140" exon 553..619 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 558 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="g" /replace="t" /db_xref="dbSNP:75508780" variation 568 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:187519642" variation 585 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /replace="t" /db_xref="dbSNP:139126094" variation 599 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:149507748" exon 620..668 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 646 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:372003626" exon 669..773 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 680 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="g" /replace="t" /db_xref="dbSNP:377269248" variation 716 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:370842930" variation 718 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:189334175" variation 722 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:180828525" STS 723..819 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /standard_name="D12S1228E" /db_xref="UniSTS:151475" variation 727 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:139855321" variation 770 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:143307709" exon 774..956 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 777 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:200126349" variation 801 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:372334618" variation 818 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:139114802" variation 828 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:376319241" variation 855 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:142950109" variation 874 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="g" /replace="t" /db_xref="dbSNP:369666651" variation 880 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:367848953" variation 899 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:151118398" variation 936 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:201709857" variation 950 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:374020928" exon 957..1015 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" exon 1016..1064 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 1042 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:141118279" variation 1043 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:11540899" exon 1065..1161 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 1070 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:147937477" variation 1112 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:369005585" variation 1132 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:374021528" variation 1133 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:367577378" variation 1137 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:371301313" exon 1162..1289 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 1171 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:62001055" variation 1172 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:813000" variation 1186 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:372464298" variation 1206 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="c" /db_xref="dbSNP:114381819" variation 1210 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:139906438" variation 1214 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="g" /replace="t" /db_xref="dbSNP:149786604" variation 1227 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:371828253" variation 1232 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:200271633" variation 1236 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:145765083" variation 1237 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:375278390" variation 1286 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:370845468" exon 1290..1356 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 1296 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:803064" variation 1297 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:368235304" variation 1305 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:144199298" variation 1306 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:146554363" variation 1336 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="c" /db_xref="dbSNP:199558313" variation 1342 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:140386892" exon 1357..1469 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 1376 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:199776060" variation 1377 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:150976222" variation 1382 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:140831161" variation 1391 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:371715592" variation 1407 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:375776301" variation 1444 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:150151598" variation 1459 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:2230102" variation 1469 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:199822336" exon 1470..1586 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 1479 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:138450169" variation 1484 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:369806479" variation 1500 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="g" /replace="t" /db_xref="dbSNP:142767232" variation 1532 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:146927122" variation 1539 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:2230103" variation 1542 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="c" /db_xref="dbSNP:118010189" variation 1565 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:373393100" variation 1584 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:144393643" variation 1585 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:148760130" exon 1587..1670 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 1593 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:187131238" variation 1606 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:370290068" variation 1607 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:375513246" variation 1614 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:141515782" variation 1615 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:202149844" variation 1621 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:150890071" variation 1631 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:111537304" variation 1632 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:139293638" variation 1637 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:144329021" variation 1638 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:146049827" variation 1668 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:371285615" variation 1669 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:140034854" exon 1671..1727 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 1681 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:1293839" variation 1715 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:372229678" exon 1728..1808 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 1732 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:144124584" variation 1758 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:372479780" STS 1759..1843 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /standard_name="MARC_4357-4358:991938494:5" /db_xref="UniSTS:231083" variation 1759 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:145083539" variation 1767 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:201615556" exon 1809..1873 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 1818 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:367747037" variation 1823 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:149124693" variation 1832 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:200899513" variation 1833 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:142155041" variation 1835 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:151204833" exon 1874..2811 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /inference="alignment:Splign:1.39.8" variation 1877 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:141196267" variation 1878 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:376508181" variation 1901 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:200345816" variation 1902 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="g" /db_xref="dbSNP:377645698" variation 1914 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:369144524" variation 1928 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:112505360" variation 1939..1940 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="" /replace="g" /db_xref="dbSNP:146386435" variation 1961 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:199575958" variation 1962 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:373876353" variation 1968 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:909128" variation 1972 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:201628239" variation 1973 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:377408845" variation 1979 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:374386627" variation 1999 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:1296069" variation 2056 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:151048012" variation 2082 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:141097964" variation 2116 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:150278456" variation 2154 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="t" /db_xref="dbSNP:2734615" variation 2162 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:185803208" variation 2175 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:75580662" variation 2193 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:191591974" variation 2221 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:41275221" variation 2290 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:182997186" variation 2349 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:113634317" variation 2350 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="c" /db_xref="dbSNP:188776036" variation 2378 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /db_xref="dbSNP:147926104" variation 2453 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="t" /db_xref="dbSNP:77369840" STS 2547..2809 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /standard_name="WI-21075" /db_xref="UniSTS:50237" variation 2548 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:192033664" STS 2653..2810 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /standard_name="RH44454" /db_xref="UniSTS:53362" variation 2660 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:8950" variation 2669 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:1056363" variation 2670 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:141716299" variation 2686 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="t" /db_xref="dbSNP:182766749" variation 2692 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="t" /db_xref="dbSNP:75104200" variation 2721 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="a" /replace="c" /db_xref="dbSNP:1056386" variation 2747 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:9691899" polyA_signal 2791..2796 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" variation 2809 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" /replace="c" /replace="t" /db_xref="dbSNP:73187873" polyA_site 2811 /gene="CUX1" /gene_synonym="CASP; CDP; CDP/Cut; CDP1; Clox; COY1; CUTL1; CUX; Cux/CDP; GOLIM6; Nbla10317; p100; p110; p200; p75" ORIGIN
actccgtctcaatatgtctcaagatggcggccaatgtgggatcgatgtttcaatattggaagcgctttgatttacagcagctgcaggatttgcgcaagcaggtagcgccgctgctgaagagtttccaaggagagattgatgcactgagtaaaagaagcaaggaagctgaagcagctttcttgaatgtctacaaaagattgattgacgtcccagatcccgtaccagctttggatctcggacagcaactccagctcaaagtgcagcgcctgcacgatattgaaacagagaaccagaaacttagggaaactctggaagaatacaacaaggaatttgctgaagtgaaaaatcaagaggttacgataaaagcacttaaagagaaaatccgagaatatgaacagacactgaagaaccaagccgaaaccatagctcttgagaaggaacagaagttacagaatgactttgcagaaaaggagagaaagctgcaggagacacagatgtccaccacctcaaagctggaggaagctgagcataaggttcagagcctacaaacagccctggaaaaaactcgaacagaattatttgacctgaaaaccaaatacgatgaagaaactactgcaaaggccgacgagattgaaatgatcatgacggaccttgaaagggcaaaccagagggcagaggtggctcagagagaggcggagaccttaagggaacagctctcatcggccaatcactccctccagctggcctcacagatccagaaggcaccagacgtggccatagaggtgctgacccgctccagcctagaagttgagttggccgccaaggagcgggagatcgcacagctggtggaggacgtgcagagactccaggccagcctcaccaagctgcgggagaattcggccagccagatctcacagcttgagcagcagctgagcgccaaaaacagcacactcaaacaactggaagaaaaactcaaaggccaggctgactatgaagaggtgaagaaagagctgaacattctgaagtccatggagtttgcaccgtccgagggcgctgggacacaggatgcggccaagcccctggaggtgctgttgctggagaagaaccgctcgctgcagtccgagaacgccgcgctgcgcatctccaacagcgacctgagcggacgctgtgcagagctgcaagtccgtatcactgaggctgtggccacagccactgagcagagagagctgatcgcccgcctggagcaggacctgagcatcattcagtccatccagcggcccgatgccgagggtgccgctgagcaccgcctggagaagatcccagagcccatcaaagaggccactgccctattctacggacctgcagcaccagccagcggtgccctcccagagggccaggtggattcactgctttccatcatctccagccagagggagcgcttccgtgcccggaaccaggagcttgaggccgagaaccgcctggcccagcacaccctccaggccctgcagagtgagctggacagcctgcgcgccgacaacatcaagctctttgagaagatcaagttcctgcagagctaccctggccggggcagcggcagtgatgacacggagctgcggtactcgtcccagtacgaggagcgcctggaccccttctcctccttcagcaagcgggagcggcagaggaagtacctgagcttgagtccctgggacaaggccaccctcagcatggggcgtctggttctctccaacaagatggcgcgcaccatcggcttcttctacacactgttcctgcactgcctggtcttcctggtgctctacaagctggcatggagcgagagcatggagagggactgtgccaccttctgcgccaagaagttcgctgaccacctgcacaagttccacgagaatgacaacggggctgcggctggtgacttgtggcagtgataccccggggcctcccccgtgacagtgacggctgcgcctccaccccgactgctcagtgcatctaatcacttagactcccctgaagaatcccccatggaaactgcccttatccgctgtccagcagctgccagaggccccaggtcacctcgggtccccttgaaagaatgtctcggtcacatcaggcccgctaggtccagagagcgagcccccaatgcccggccaggctaagccgcagagaccctctcagcccccacctcaggttagggctctgcccgcagcctgacctctagccctggtggcagaggtccctcagctgcgaggctaattgggtgaccaccgattccagctgcggttaatccagcttgggcctgtctgcactgcgatcctcttgggctctcctaggatccccccatgccccgtaagaggtggaagacgcttccttccaggacagcaggctttgagtccagcacccccagcctgcctttgccaccagccccaccctgcagagtatatgaggcttgacagagtctgccccctcccccactgcaccccaagagagagagccccagccagcggaacagtttctattaccccctccctgcccccagacccatgtgatttctgctttcttctttagcaagatattctggtttctagataaggaagagtctctaatgagcccccgagccccagtctcttcagactcatggattggtctgaggggtctgaacgtctcctagccaatcagaactggctgtggaccaccctagcacggccacctctcagggccactggcaggccttcctgagttagatttgtagttgcatatttagctttgcacatttgaaataaaccacggttgcagccaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:1523 -> Molecular function: GO:0003682 [chromatin binding] evidence: IEA GeneID:1523 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA GeneID:1523 -> Molecular function: GO:0030674 [protein binding, bridging] evidence: IEA GeneID:1523 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA GeneID:1523 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IEA GeneID:1523 -> Biological process: GO:0000301 [retrograde transport, vesicle recycling within Golgi] evidence: IEA GeneID:1523 -> Biological process: GO:0001822 [kidney development] evidence: IEA GeneID:1523 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA GeneID:1523 -> Biological process: GO:0006357 [regulation of transcription from RNA polymerase II promoter] evidence: TAS GeneID:1523 -> Biological process: GO:0006891 [intra-Golgi vesicle-mediated transport] evidence: IEA GeneID:1523 -> Biological process: GO:0007275 [multicellular organismal development] evidence: TAS GeneID:1523 -> Biological process: GO:0030324 [lung development] evidence: IEA GeneID:1523 -> Biological process: GO:0042491 [auditory receptor cell differentiation] evidence: IEA GeneID:1523 -> Cellular component: GO:0000139 [Golgi membrane] evidence: IEA GeneID:1523 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:1523 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA GeneID:1523 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA GeneID:1523 -> Cellular component: GO:0005829 [cytosol] evidence: TAS GeneID:1523 -> Cellular component: GO:0030173 [integral to Golgi membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.