2025-05-09 20:12:06, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001146340 971 bp mRNA linear PRI 07-JUL-2013 DEFINITION Homo sapiens NK1 homeobox 2 (NKX1-2), mRNA. ACCESSION NM_001146340 XM_001724117 XM_372331 XM_940698 VERSION NM_001146340.1 GI:226437601 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 971) AUTHORS Rovescalli,A.C., Cinquanta,M., Ferrante,J., Kozak,C.A. and Nirenberg,M. TITLE The mouse Nkx-1.2 homeobox gene: alternative RNA splicing at canonical and noncanonical splice sites JOURNAL Proc. Natl. Acad. Sci. U.S.A. 97 (5), 1982-1987 (2000) PUBMED 10681422 COMMENT INFERRED REFSEQ: This record is predicted by genome sequence analysis and is not yet supported by experimental evidence. The reference sequence was derived from AL445237.16. On or before Apr 9, 2009 this sequence version replaced gi:169201470, gi:169190738, gi:169201822. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. CCDS Note: This CCDS representation lacks full-length human transcript support. Its exon combination is therefore inferred, but it is supported by the full-length orthologous transcript in mouse (AF222444.1). ##Evidence-Data-START## RNAseq introns :: single sample supports all introns ERS025084 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## inferred exon combination :: based on alignments, homology ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-252 AL445237.16 120850-121101 c 253-971 AL445237.16 118549-119267 c FEATURES Location/Qualifiers source 1..971 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="10" /map="10q26.13" gene 1..971 /gene="NKX1-2" /gene_synonym="bB238F13.2; C10orf121; NKX-1.1" /note="NK1 homeobox 2" /db_xref="GeneID:390010" /db_xref="HGNC:31652" exon 1..252 /gene="NKX1-2" /gene_synonym="bB238F13.2; C10orf121; NKX-1.1" /inference="alignment:Splign:1.39.8" CDS 39..971 /gene="NKX1-2" /gene_synonym="bB238F13.2; C10orf121; NKX-1.1" /note="homeobox protein SAX-1; NK1 transcription factor related, locus 2" /codon_start=1 /product="NK1 transcription factor-related protein 2" /protein_id="NP_001139812.1" /db_xref="GI:226437602" /db_xref="CCDS:CCDS59221.1" /db_xref="GeneID:390010" /db_xref="HGNC:31652" /translation="
MLAWQDGGAKAAPSHHKISFSVLDILDPQKFTRAALPAVRPAPREARKSLAEVEAGKDASSRDPVRQLETPDAAGPGAGQASPLEGSEAEEEEDAEDPRRPRLRERAARLLPGLARSPDAPAGALASGEPCEDGGGGPVRSPPGSPGSPRPRRRRLEPNCAKPRRARTAFTYEQLVALENKFRATRYLSVCERLNLALSLSLTETQVKIWFQNRRTKWKKQNPGADGAAQVGGGAPQPGAAGGGGGGGSGGSPGPPGTGALHFQTFPSYSAANVLFPSAASFPLTAAAPGSPFAPFLGPSYLTPFYAPRL
" misc_feature 528..704 /gene="NKX1-2" /gene_synonym="bB238F13.2; C10orf121; NKX-1.1" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:28970" misc_feature order(528..542,546..548,597..599,615..617,654..656, 660..665,672..677,681..689,693..698) /gene="NKX1-2" /gene_synonym="bB238F13.2; C10orf121; NKX-1.1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:28970" misc_feature order(534..536,543..545,663..665,672..677,684..686) /gene="NKX1-2" /gene_synonym="bB238F13.2; C10orf121; NKX-1.1" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:28970" exon 253..971 /gene="NKX1-2" /gene_synonym="bB238F13.2; C10orf121; NKX-1.1" /inference="alignment:Splign:1.39.8" variation 287 /gene="NKX1-2" /gene_synonym="bB238F13.2; C10orf121; NKX-1.1" /replace="c" /replace="g" /db_xref="dbSNP:3916136" ORIGIN
accccgcgccgccgaccgccggcccgtgggcgacgggcatgctggcatggcaggacggcggggccaaggcggctccctcccaccacaagatttctttctctgtcctggacatcctggacccacagaaattcacccgcgcagcgctccctgccgtgcgcccggctccccgggaagccaggaaaagtttggcggaggtcgaagcggggaaagatgccagctccagggaccctgtccgacagctggagacccctgatgctgcgggcccaggcgccggccaggcgtcccccctggagggttccgaggcggaagaggaggaggatgcggaggatccgaggaggccgcggctgcgggagcgggctgcgcgcttgctgccgggcctagcgcgctcacctgacgccccggccggggcattggcgtctggggagccctgcgaggacggcgggggcggccctgtgaggtcccccccgggatcccccggctccccgcgtcccaggcgccggcgcctggagcccaactgcgccaagccgcggcgcgcgcgcaccgccttcacctacgagcagctggtggccttggagaacaagttccgggccacgcgctacctgtcagtgtgcgagcgcctgaacctcgcgctgtctctcagcctcaccgagacgcaggtcaaaatctggttccagaatcgcaggaccaagtggaagaagcagaacccgggtgccgacggcgcggcgcaggtggggggtggcgcgccccagccaggggcggcggggggcggcggcggcggcggctcggggggcagtcctggccctcccggcaccggcgctctgcacttccagactttcccctcctactccgcggccaatgtcctcttcccgtccgccgcctccttcccgctgacggctgccgcccccgggagccctttcgcgccgttccttgggccttcctacctgacccccttctacgccccgcgtctatga
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:390010 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA GeneID:390010 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA GeneID:390010 -> Biological process: GO:0007275 [multicellular organismal development] evidence: IEA GeneID:390010 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.