GGRNA Home | Help | Advanced search

2025-05-09 20:12:06, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001146340             971 bp    mRNA    linear   PRI 07-JUL-2013
DEFINITION  Homo sapiens NK1 homeobox 2 (NKX1-2), mRNA.
ACCESSION   NM_001146340 XM_001724117 XM_372331 XM_940698
VERSION     NM_001146340.1  GI:226437601
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 971)
  AUTHORS   Rovescalli,A.C., Cinquanta,M., Ferrante,J., Kozak,C.A. and
            Nirenberg,M.
  TITLE     The mouse Nkx-1.2 homeobox gene: alternative RNA splicing at
            canonical and noncanonical splice sites
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 97 (5), 1982-1987 (2000)
   PUBMED   10681422
COMMENT     INFERRED REFSEQ: This record is predicted by genome sequence
            analysis and is not yet supported by experimental evidence. The
            reference sequence was derived from AL445237.16.
            On or before Apr 9, 2009 this sequence version replaced
            gi:169201470, gi:169190738, gi:169201822.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            CCDS Note: This CCDS representation lacks full-length human
            transcript support. Its exon combination is therefore inferred, but
            it is supported by the full-length orthologous transcript in mouse
            (AF222444.1).
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns ERS025084
                              [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            inferred exon combination :: based on alignments, homology
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-252               AL445237.16        120850-121101       c
            253-971             AL445237.16        118549-119267       c
FEATURES             Location/Qualifiers
     source          1..971
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="10"
                     /map="10q26.13"
     gene            1..971
                     /gene="NKX1-2"
                     /gene_synonym="bB238F13.2; C10orf121; NKX-1.1"
                     /note="NK1 homeobox 2"
                     /db_xref="GeneID:390010"
                     /db_xref="HGNC:31652"
     exon            1..252
                     /gene="NKX1-2"
                     /gene_synonym="bB238F13.2; C10orf121; NKX-1.1"
                     /inference="alignment:Splign:1.39.8"
     CDS             39..971
                     /gene="NKX1-2"
                     /gene_synonym="bB238F13.2; C10orf121; NKX-1.1"
                     /note="homeobox protein SAX-1; NK1 transcription factor
                     related, locus 2"
                     /codon_start=1
                     /product="NK1 transcription factor-related protein 2"
                     /protein_id="NP_001139812.1"
                     /db_xref="GI:226437602"
                     /db_xref="CCDS:CCDS59221.1"
                     /db_xref="GeneID:390010"
                     /db_xref="HGNC:31652"
                     /translation="
MLAWQDGGAKAAPSHHKISFSVLDILDPQKFTRAALPAVRPAPREARKSLAEVEAGKDASSRDPVRQLETPDAAGPGAGQASPLEGSEAEEEEDAEDPRRPRLRERAARLLPGLARSPDAPAGALASGEPCEDGGGGPVRSPPGSPGSPRPRRRRLEPNCAKPRRARTAFTYEQLVALENKFRATRYLSVCERLNLALSLSLTETQVKIWFQNRRTKWKKQNPGADGAAQVGGGAPQPGAAGGGGGGGSGGSPGPPGTGALHFQTFPSYSAANVLFPSAASFPLTAAAPGSPFAPFLGPSYLTPFYAPRL
"
     misc_feature    528..704
                     /gene="NKX1-2"
                     /gene_synonym="bB238F13.2; C10orf121; NKX-1.1"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(528..542,546..548,597..599,615..617,654..656,
                     660..665,672..677,681..689,693..698)
                     /gene="NKX1-2"
                     /gene_synonym="bB238F13.2; C10orf121; NKX-1.1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(534..536,543..545,663..665,672..677,684..686)
                     /gene="NKX1-2"
                     /gene_synonym="bB238F13.2; C10orf121; NKX-1.1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     exon            253..971
                     /gene="NKX1-2"
                     /gene_synonym="bB238F13.2; C10orf121; NKX-1.1"
                     /inference="alignment:Splign:1.39.8"
     variation       287
                     /gene="NKX1-2"
                     /gene_synonym="bB238F13.2; C10orf121; NKX-1.1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3916136"
ORIGIN      
accccgcgccgccgaccgccggcccgtgggcgacgggcatgctggcatggcaggacggcggggccaaggcggctccctcccaccacaagatttctttctctgtcctggacatcctggacccacagaaattcacccgcgcagcgctccctgccgtgcgcccggctccccgggaagccaggaaaagtttggcggaggtcgaagcggggaaagatgccagctccagggaccctgtccgacagctggagacccctgatgctgcgggcccaggcgccggccaggcgtcccccctggagggttccgaggcggaagaggaggaggatgcggaggatccgaggaggccgcggctgcgggagcgggctgcgcgcttgctgccgggcctagcgcgctcacctgacgccccggccggggcattggcgtctggggagccctgcgaggacggcgggggcggccctgtgaggtcccccccgggatcccccggctccccgcgtcccaggcgccggcgcctggagcccaactgcgccaagccgcggcgcgcgcgcaccgccttcacctacgagcagctggtggccttggagaacaagttccgggccacgcgctacctgtcagtgtgcgagcgcctgaacctcgcgctgtctctcagcctcaccgagacgcaggtcaaaatctggttccagaatcgcaggaccaagtggaagaagcagaacccgggtgccgacggcgcggcgcaggtggggggtggcgcgccccagccaggggcggcggggggcggcggcggcggcggctcggggggcagtcctggccctcccggcaccggcgctctgcacttccagactttcccctcctactccgcggccaatgtcctcttcccgtccgccgcctccttcccgctgacggctgccgcccccgggagccctttcgcgccgttccttgggccttcctacctgacccccttctacgccccgcgtctatga
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:390010 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA
            GeneID:390010 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
            GeneID:390010 -> Biological process: GO:0007275 [multicellular organismal development] evidence: IEA
            GeneID:390010 -> Cellular component: GO:0005634 [nucleus] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.