GGRNA | NM_001127388.2

LOCUS       NM_001127388            1380 bp    mRNA    linear   PRI 07-MAY-2013
DEFINITION  Homo sapiens double homeobox 4 like 6 (DUX4L6), mRNA.
ACCESSION   NM_001127388 XM_928003
VERSION     NM_001127388.2  GI:489406854
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1380)
  AUTHORS   Dixit,M., Ansseau,E., Tassin,A., Winokur,S., Shi,R., Qian,H.,
            Sauvage,S., Matteotti,C., van Acker,A.M., Leo,O., Figlewicz,D.,
            Barro,M., Laoudj-Chenivesse,D., Belayew,A., Coppee,F. and Chen,Y.W.
  TITLE     DUX4, a candidate gene of facioscapulohumeral muscular dystrophy,
            encodes a transcriptional activator of PITX1
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 104 (46), 18157-18162 (2007)
   PUBMED   17984056
REFERENCE   2  (bases 1 to 1380)
  AUTHORS   Clapp,J., Mitchell,L.M., Bolland,D.J., Fantes,J., Corcoran,A.E.,
            Scotting,P.J., Armour,J.A. and Hewitt,J.E.
  TITLE     Evolutionary conservation of a coding function for D4Z4, the tandem
            DNA repeat mutated in facioscapulohumeral muscular dystrophy
  JOURNAL   Am. J. Hum. Genet. 81 (2), 264-279 (2007)
   PUBMED   17668377
REFERENCE   3  (bases 1 to 1380)
  AUTHORS   Kowaljow,V., Marcowycz,A., Ansseau,E., Conde,C.B., Sauvage,S.,
            Matteotti,C., Arias,C., Corona,E.D., Nunez,N.G., Leo,O.,
            Wattiez,R., Figlewicz,D., Laoudj-Chenivesse,D., Belayew,A.,
            Coppee,F. and Rosa,A.L.
  TITLE     The DUX4 gene at the FSHD1A locus encodes a pro-apoptotic protein
  JOURNAL   Neuromuscul. Disord. 17 (8), 611-623 (2007)
   PUBMED   17588759
REFERENCE   4  (bases 1 to 1380)
  AUTHORS   Beckers,M., Gabriels,J., van der Maarel,S., De Vriese,A.,
            Frants,R.R., Collen,D. and Belayew,A.
  TITLE     Active genes in junk DNA? Characterization of DUX genes embedded
            within 3.3 kb repeated elements
  JOURNAL   Gene 264 (1), 51-57 (2001)
   PUBMED   11245978
REFERENCE   5  (bases 1 to 1380)
  AUTHORS   Gabriels,J., Beckers,M.C., Ding,H., De Vriese,A., Plaisance,S., van
            der Maarel,S.M., Padberg,G.W., Frants,R.R., Hewitt,J.E., Collen,D.
            and Belayew,A.
  TITLE     Nucleotide sequence of the partially deleted D4Z4 locus in a
            patient with FSHD identifies a putative gene within each 3.3 kb
            element
  JOURNAL   Gene 236 (1), 25-32 (1999)
   PUBMED   10433963
REFERENCE   6  (bases 1 to 1380)
  AUTHORS   Ding,H., Beckers,M.C., Plaisance,S., Marynen,P., Collen,D. and
            Belayew,A.
  TITLE     Characterization of a double homeodomain protein (DUX1) encoded by
            a cDNA homologous to 3.3 kb dispersed repeated elements
  JOURNAL   Hum. Mol. Genet. 7 (11), 1681-1694 (1998)
   PUBMED   9736770
REFERENCE   7  (bases 1 to 1380)
  AUTHORS   Lee,J.H., Goto,K., Matsuda,C. and Arahata,K.
  TITLE     Characterization of a tandemly repeated 3.3-kb KpnI unit in the
            facioscapulohumeral muscular dystrophy (FSHD) gene region on
            chromosome 4q35
  JOURNAL   Muscle Nerve Suppl 2, S6-S13 (1995)
   PUBMED   7739628
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC126281.3.
            On May 7, 2013 this sequence version replaced gi:188497731.
            
            Sequence Note: This RefSeq record was created from genomic sequence
            data because no transcripts are available to represent this gene.
            The extent of this RefSeq is supported by similar human loci.
            PubMedID: 17588759 shows some evidence that this locus is
            transcribed and is protein-coding.
            COMPLETENESS: complete on the 5' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1380              AC126281.3         6187-7566
FEATURES             Location/Qualifiers
     source          1..1380
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="4"
                     /map="4q35.2"
     gene            1..1380
                     /gene="DUX4L6"
                     /note="double homeobox 4 like 6"
                     /db_xref="GeneID:653544"
                     /db_xref="HGNC:37265"
     exon            1..1380
                     /gene="DUX4L6"
                     /inference="alignment:Splign:1.39.8"
     CDS             98..1372
                     /gene="DUX4L6"
                     /codon_start=1
                     /product="double homeobox protein 4-like protein 6"
                     /protein_id="NP_001120860.3"
                     /db_xref="GI:489406855"
                     /db_xref="GeneID:653544"
                     /db_xref="HGNC:37265"
                     /translation="

MALPTPSDSTLPAEARGRGRRRRLVWTPSQSEALRACFERNPYPGIATRERLAQAIGIPEPRVQIWFQNERSRQLRQHRRESRPWPGRRGPPEGRRKRTAVTGSQTALLLRAFEKDRFPGIAAREELARETGLPESRIQIWFQNRRARHPGQGGRAPAQAGGLCSAAPGGGHPAPSWVAFAHTGAWGTGLPAPHVPCAPGALPQGAFVSQAARAAPALQPSQAAPAEGVSQPAPARGDFAYAAPAPPDGALSHPQAPRWPPHPGKSREDRDPQRDGLPGPCAVAQPGPAQAGPQGQGVLAPPTSQGSPWWGWGRGPQVAGAAWEPQAGAAPPPQPAPPDASASARQGQMQGIPAPSQALQEPAPWSALPCGLLLDELLASPEFLQQAQPLLETEAPGELEASEEAASLEAPLSEEEYRALLEEL

"
     misc_feature    170..331
                     /gene="DUX4L6"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:238039"
     misc_feature    order(170..172,290..292,299..304,311..313)
                     /gene="DUX4L6"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     misc_feature    order(173..175,224..226,242..244,281..283,287..292,
                     299..304,308..316,320..325)
                     /gene="DUX4L6"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    401..544
                     /gene="DUX4L6"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:238039"
     misc_feature    order(449..451,467..469,506..508,512..517,524..529,
                     533..541)
                     /gene="DUX4L6"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(515..517,524..529,536..538)
                     /gene="DUX4L6"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
ORIGIN

acctgccgcagtgcacagtccggctgaggtgcacgggagcccgccggcctctctctgcccgcgtccgtccgtgaaattccggccggggctcaccgcgatggccctcccgacaccctcggacagcaccctccccgcggaagcccggggacgaggacggcgacggagactcgtttggaccccgagccaaagcgaggccctgcgagcctgctttgagcggaacccgtacccgggcatcgccaccagagaacggctggcccaggccatcggcattccggagcccagggtccagatttggtttcagaatgagaggtcacgccagctgaggcagcaccggcgggaatctcggccctggcccgggagacgcggcccgccagaaggccggcgaaagcggaccgccgtcaccggatcccagaccgccctgctcctccgagcctttgagaaggatcgctttccaggcatcgccgcccgggaggagctggccagagagacgggcctcccggagtccaggattcagatctggtttcagaatcgaagggccaggcacccgggacagggtggcagggcgcccgcgcaggcaggcggcctgtgcagcgcggcccccggcgggggtcaccctgctccctcgtgggtcgccttcgcccacaccggcgcgtggggaacggggcttcccgcaccccacgtgccctgcgcgcctggggctctcccacagggggctttcgtgagccaggcagcgagggccgcccccgcgctgcagcccagccaggccgcgccggcagagggggtctcccaacctgccccggcgcgcggggatttcgcctacgccgccccggctcctccggacggggcgctctcccaccctcaggctcctcggtggcctccgcacccgggcaaaagccgggaggaccgggacccgcagcgcgacggcctgccgggcccctgcgcggtggcacagcctgggcccgctcaagcggggccgcagggccaaggggtgcttgcgccacccacgtcccaggggagtccgtggtggggctggggccggggtccccaggtcgccggggcggcgtgggaaccccaagccggggcagctccacctccccagcccgcgcccccggacgcctccgcctccgcgcggcaggggcagatgcaaggcatcccggcgccctcccaggcgctccaggagccggcgccctggtctgcactcccctgcggcctgctgctggatgagctcctggcgagcccggagtttctgcagcaggcgcaacctctcctagaaacggaggccccgggggagctggaggcctcggaagaggccgcctcgctggaagcacccctcagcgaggaagaataccgggctctgctggaggagctttaggacgcggg

//

Annotations: