GGRNA Home | Help | Advanced search

2025-06-07 15:25:57, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001098169             702 bp    mRNA    linear   PRI 06-JAN-2013
DEFINITION  Homo sapiens brain-specific homeobox (BSX), mRNA.
ACCESSION   NM_001098169 XM_372433 XM_939530
VERSION     NM_001098169.1  GI:147901461
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 702)
  AUTHORS   Elks,C.E., Perry,J.R., Sulem,P., Chasman,D.I., Franceschini,N.,
            He,C., Lunetta,K.L., Visser,J.A., Byrne,E.M., Cousminer,D.L.,
            Gudbjartsson,D.F., Esko,T., Feenstra,B., Hottenga,J.J.,
            Koller,D.L., Kutalik,Z., Lin,P., Mangino,M., Marongiu,M.,
            McArdle,P.F., Smith,A.V., Stolk,L., van Wingerden,S.H., Zhao,J.H.,
            Albrecht,E., Corre,T., Ingelsson,E., Hayward,C., Magnusson,P.K.,
            Smith,E.N., Ulivi,S., Warrington,N.M., Zgaga,L., Alavere,H.,
            Amin,N., Aspelund,T., Bandinelli,S., Barroso,I., Berenson,G.S.,
            Bergmann,S., Blackburn,H., Boerwinkle,E., Buring,J.E., Busonero,F.,
            Campbell,H., Chanock,S.J., Chen,W., Cornelis,M.C., Couper,D.,
            Coviello,A.D., d'Adamo,P., de Faire,U., de Geus,E.J., Deloukas,P.,
            Doring,A., Smith,G.D., Easton,D.F., Eiriksdottir,G., Emilsson,V.,
            Eriksson,J., Ferrucci,L., Folsom,A.R., Foroud,T., Garcia,M.,
            Gasparini,P., Geller,F., Gieger,C., Gudnason,V., Hall,P.,
            Hankinson,S.E., Ferreli,L., Heath,A.C., Hernandez,D.G., Hofman,A.,
            Hu,F.B., Illig,T., Jarvelin,M.R., Johnson,A.D., Karasik,D.,
            Khaw,K.T., Kiel,D.P., Kilpelainen,T.O., Kolcic,I., Kraft,P.,
            Launer,L.J., Laven,J.S., Li,S., Liu,J., Levy,D., Martin,N.G.,
            McArdle,W.L., Melbye,M., Mooser,V., Murray,J.C., Murray,S.S.,
            Nalls,M.A., Navarro,P., Nelis,M., Ness,A.R., Northstone,K.,
            Oostra,B.A., Peacock,M., Palmer,L.J., Palotie,A., Pare,G.,
            Parker,A.N., Pedersen,N.L., Peltonen,L., Pennell,C.E., Pharoah,P.,
            Polasek,O., Plump,A.S., Pouta,A., Porcu,E., Rafnar,T., Rice,J.P.,
            Ring,S.M., Rivadeneira,F., Rudan,I., Sala,C., Salomaa,V., Sanna,S.,
            Schlessinger,D., Schork,N.J., Scuteri,A., Segre,A.V.,
            Shuldiner,A.R., Soranzo,N., Sovio,U., Srinivasan,S.R.,
            Strachan,D.P., Tammesoo,M.L., Tikkanen,E., Toniolo,D., Tsui,K.,
            Tryggvadottir,L., Tyrer,J., Uda,M., van Dam,R.M., van Meurs,J.B.,
            Vollenweider,P., Waeber,G., Wareham,N.J., Waterworth,D.M.,
            Weedon,M.N., Wichmann,H.E., Willemsen,G., Wilson,J.F., Wright,A.F.,
            Young,L., Zhai,G., Zhuang,W.V., Bierut,L.J., Boomsma,D.I.,
            Boyd,H.A., Crisponi,L., Demerath,E.W., van Duijn,C.M., Econs,M.J.,
            Harris,T.B., Hunter,D.J., Loos,R.J., Metspalu,A., Montgomery,G.W.,
            Ridker,P.M., Spector,T.D., Streeten,E.A., Stefansson,K.,
            Thorsteinsdottir,U., Uitterlinden,A.G., Widen,E., Murabito,J.M.,
            Ong,K.K. and Murray,A.
  CONSRTM   GIANT Consortium
  TITLE     Thirty new loci for age at menarche identified by a meta-analysis
            of genome-wide association studies
  JOURNAL   Nat. Genet. 42 (12), 1077-1085 (2010)
   PUBMED   21102462
REFERENCE   2  (bases 1 to 702)
  AUTHORS   Coldren,C.D., Lai,Z., Shragg,P., Rossi,E., Glidewell,S.C.,
            Zuffardi,O., Mattina,T., Ivy,D.D., Curfs,L.M., Mattson,S.N.,
            Riley,E.P., Treier,M. and Grossfeld,P.D.
  TITLE     Chromosomal microarray mapping suggests a role for BSX and
            Neurogranin in neurocognitive and behavioral defects in the 11q
            terminal deletion disorder (Jacobsen syndrome)
  JOURNAL   Neurogenetics 10 (2), 89-95 (2009)
   PUBMED   18855024
  REMARK    GeneRIF: Data suggest that BSX is essential for global cognitive
            function and that haplo-insufficiency may cause severe mental
            retardation, and that deletion of Neurogranin
REFERENCE   3  (bases 1 to 702)
  AUTHORS   Chu,H.Y. and Ohtoshi,A.
  TITLE     Cloning and functional analysis of hypothalamic homeobox gene Bsx1a
            and its isoform, Bsx1b
  JOURNAL   Mol. Cell. Biol. 27 (10), 3743-3749 (2007)
   PUBMED   17353277
REFERENCE   4  (bases 1 to 702)
  AUTHORS   Cremona,M., Colombo,E., Andreazzoli,M., Cossu,G. and Broccoli,V.
  TITLE     Bsx, an evolutionary conserved Brain Specific homeoboX gene
            expressed in the septum, epiphysis, mammillary bodies and arcuate
            nucleus
  JOURNAL   Gene Expr. Patterns 4 (1), 47-51 (2004)
   PUBMED   14678827
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AP003040.2 and AB231738.1.
            On or before May 23, 2007 this sequence version replaced
            gi:51468681, gi:89035198.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-43                AP003040.2         36843-36885         c
            44-162              AB231738.1         1-119
            163-163             AP003040.2         36723-36723         c
            164-280             AB231738.1         121-237
            281-459             AP003040.2         34475-34653         c
            460-702             AP003040.2         32863-33105         c
FEATURES             Location/Qualifiers
     source          1..702
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="11"
                     /map="11q24.1"
     gene            1..702
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /note="brain-specific homeobox"
                     /db_xref="GeneID:390259"
                     /db_xref="HGNC:20450"
                     /db_xref="MIM:611074"
     CDS             1..702
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /note="brain specific homeobox"
                     /codon_start=1
                     /product="brain-specific homeobox protein homolog"
                     /protein_id="NP_001091639.1"
                     /db_xref="GI:147901462"
                     /db_xref="CCDS:CCDS41728.1"
                     /db_xref="GeneID:390259"
                     /db_xref="HGNC:20450"
                     /db_xref="MIM:611074"
                     /translation="
MNLNFTSPLHPASSQRPTSFFIEDILLHKPKPLREVAPDHFASSLASRVPLLDYGYPLMPTPTLLAPHAHHPLHKGDHHHPYFLTTSGMPVPALFPHPQHAELPGKHCRRRKARTVFSDSQLSGLEKRFEIQRYLSTPERVELATALSLSETQVKTWFQNRRMKHKKQLRKSQDEPKAPDGPESPEGSPRGSEAATAAEARLSLPAGPFVLTEPEDEVDIGDEGELGSGPHVL
"
     misc_feature    331..504
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(331..345,349..351,400..402,418..420,457..459,
                     463..468,475..480,484..492,496..501)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(337..339,346..348,466..468,475..480,487..489)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     exon            1..262
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(31)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:62624971"
     variation       complement(76)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377550796"
     variation       complement(125)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373485666"
     variation       complement(132)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369116040"
     variation       complement(156)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370532557"
     variation       complement(168)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200026871"
     variation       complement(196)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199643758"
     variation       complement(204)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372663917"
     variation       complement(261)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370019336"
     exon            263..459
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(279)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183282025"
     variation       complement(294)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369683033"
     variation       complement(315)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375178523"
     variation       complement(319)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:371977061"
     variation       complement(353)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368119965"
     variation       complement(355)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375774927"
     variation       complement(391)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368494973"
     variation       complement(450)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190227799"
     variation       complement(456)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371265047"
     exon            460..702
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(468)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375870565"
     variation       complement(469)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375711614"
     variation       complement(518)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201802674"
     variation       complement(540)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138024906"
     variation       complement(548)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373020747"
     variation       complement(586)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:11601189"
     variation       complement(608)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199952953"
     variation       complement(690)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61737276"
     variation       complement(693)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:61737277"
     variation       complement(694)
                     /gene="BSX"
                     /gene_synonym="BSX1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199711565"
ORIGIN      
atgaatctcaacttcacctctcctctacacccggcgtcttctcagaggcccacatccttcttcatcgaggacatcctgctgcacaagcccaagccgctgagagaggtggccccagaccatttcgccagctctctggcctctcgggtgcctctgctagactatggctaccccctcatgcccacacccaccctcttggctcctcacgcccatcaccctctgcataagggagaccaccatcatccttatttcctcaccacctcggggatgccagtcccagcgctgttcccgcacccgcagcacgcggagctgccggggaagcactgccgccgccgcaaagcccgcacggttttctctgactcgcagctctcgggcttggagaagaggttcgagatccagcgctacctgtccacgccagaacgagtggagctggccacggccctcagcctgtccgagacgcaggtgaaaacgtggttccagaaccggcggatgaagcataaaaagcaactgcggaaaagccaagacgaacccaaagcaccagacgggccagaaagccccgagggcagcccccgcggttcagaggccgccaccgccgccgaggctcggctgagcctgcccgccggtcccttcgtgctgaccgagccagaggacgaggtggacattggagacgagggggagctgggctcagggccgcacgtgctctga
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:390259 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA
            GeneID:390259 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
            GeneID:390259 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
            GeneID:390259 -> Biological process: GO:0007626 [locomotory behavior] evidence: IEA
            GeneID:390259 -> Biological process: GO:0042755 [eating behavior] evidence: IEA
            GeneID:390259 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IEA
            GeneID:390259 -> Biological process: GO:0060056 [mammary gland involution] evidence: IEA
            GeneID:390259 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:390259 -> Cellular component: GO:0005667 [transcription factor complex] evidence: IEA
            GeneID:390259 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.