GGRNA Home | Help | Advanced search

2025-05-09 20:14:37, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001080458            1617 bp    mRNA    linear   PRI 15-JUN-2013
DEFINITION  Homo sapiens even-skipped homeobox 2 (EVX2), mRNA.
ACCESSION   NM_001080458 XM_292968
VERSION     NM_001080458.1  GI:122937318
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1617)
  AUTHORS   Divaris,K., Monda,K.L., North,K.E., Olshan,A.F., Lange,E.M.,
            Moss,K., Barros,S.P., Beck,J.D. and Offenbacher,S.
  TITLE     Genome-wide association study of periodontal pathogen colonization
  JOURNAL   J. Dent. Res. 91 (7 SUPPL), 21S-28S (2012)
   PUBMED   22699663
REFERENCE   2  (bases 1 to 1617)
  AUTHORS   Goodman,F.R., Majewski,F., Collins,A.L. and Scambler,P.J.
  TITLE     A 117-kb microdeletion removing HOXD9-HOXD13 and EVX2 causes
            synpolydactyly
  JOURNAL   Am. J. Hum. Genet. 70 (2), 547-555 (2002)
   PUBMED   11778160
  REMARK    GeneRIF: 117-kb microdeletion removing HOXD9-HOXD13 and EVX2 causes
            synpolydactyly
REFERENCE   3  (bases 1 to 1617)
  AUTHORS   Limongi,M.Z., Pelliccia,F., Gaddini,L. and Rocchi,A.
  TITLE     Clustering of two fragile sites and seven homeobox genes in human
            chromosome region 2q31-->q32.1
  JOURNAL   Cytogenet. Cell Genet. 90 (1-2), 151-153 (2000)
   PUBMED   11060466
REFERENCE   4  (bases 1 to 1617)
  AUTHORS   Slavotinek,A., Schwarz,C., Getty,J.F., Stecko,O., Goodman,F. and
            Kingston,H.
  TITLE     Two cases with interstitial deletions of chromosome 2 and sex
            reversal in one
  JOURNAL   Am. J. Med. Genet. 86 (1), 75-81 (1999)
   PUBMED   10440834
REFERENCE   5  (bases 1 to 1617)
  AUTHORS   Sarfarazi,M., Akarsu,A.N. and Sayli,B.S.
  TITLE     Localization of the syndactyly type II (synpolydactyly) locus to
            2q31 region and identification of tight linkage to HOXD8 intragenic
            marker
  JOURNAL   Hum. Mol. Genet. 4 (8), 1453-1458 (1995)
   PUBMED   7581388
REFERENCE   6  (bases 1 to 1617)
  AUTHORS   Rossi,E., Faiella,A., Zeviani,M., Labeit,S., Floridia,G.,
            Brunelli,S., Cammarata,M., Boncinelli,E. and Zuffardi,O.
  TITLE     Order of six loci at 2q24-q31 and orientation of the HOXD locus
  JOURNAL   Genomics 24 (1), 34-40 (1994)
   PUBMED   7896287
REFERENCE   7  (bases 1 to 1617)
  AUTHORS   D'Esposito,M., Morelli,F., Acampora,D., Migliaccio,E., Simeone,A.
            and Boncinelli,E.
  TITLE     EVX2, a human homeobox gene homologous to the even-skipped
            segmentation gene, is localized at the 5' end of HOX4 locus on
            chromosome 2
  JOURNAL   Genomics 10 (1), 43-50 (1991)
   PUBMED   1675198
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC009336.13.
            This sequence is a reference standard in the RefSeqGene project.
            On Jan 18, 2007 this sequence version replaced gi:113413336.
            
            Summary: This gene is located at the 5' end of the HOXD gene
            cluster on chromosome 2. The encoded protein is a homeobox
            transcription factor that is related to the protein encoded by the
            Drosophila even-skipped (eve) gene, a member of the pair-rule class
            of segmentation genes. A 117 kb microdeletion at the 5' end of the
            HOXD gene cluster, which includes this gene and the HOXD9-HOXD13
            genes, causes synpolydactyly, a dominantly inherited disease
            resulting in limb malformation. [provided by RefSeq, Sep 2009].
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence because no single transcript was available for the
            full length of the gene. The genomic coordinates used for the
            transcript record were based on alignments of partial ESTs,
            homologous transcripts, and data in PMID:1675198.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support ERS025090
                              [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-613               AC009336.13        67339-67951         c
            614-885             AC009336.13        66167-66438         c
            886-1617            AC009336.13        64096-64827         c
FEATURES             Location/Qualifiers
     source          1..1617
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2q31.1"
     gene            1..1617
                     /gene="EVX2"
                     /gene_synonym="EVX-2"
                     /note="even-skipped homeobox 2"
                     /db_xref="GeneID:344191"
                     /db_xref="HGNC:3507"
                     /db_xref="MIM:142991"
     exon            1..613
                     /gene="EVX2"
                     /gene_synonym="EVX-2"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    124..126
                     /gene="EVX2"
                     /gene_synonym="EVX-2"
                     /note="upstream in-frame stop codon"
     CDS             187..1617
                     /gene="EVX2"
                     /gene_synonym="EVX-2"
                     /note="eve, even-skipped homeo box homolog 2; even-skipped
                     homeo box 2 (homolog of Drosophila eve)"
                     /codon_start=1
                     /product="homeobox even-skipped homolog protein 2"
                     /protein_id="NP_001073927.1"
                     /db_xref="GI:122937319"
                     /db_xref="CCDS:CCDS33333.1"
                     /db_xref="GeneID:344191"
                     /db_xref="HGNC:3507"
                     /db_xref="MIM:142991"
                     /translation="
MMERIRKEMILMERGLHSPTAGKRFSNLSNSAGNAVLEALENSQHPARLSPRLPSAPLHSALGELPAKGKFEIDTLFNLQHTGSESTVSSEISSAAESRKKPGHYSEAAAEADMSSDVEVGCSALRSPGGLGAAQLKENNGKGYAESGSAAGTTTSASGSGLGSLHGGSGGSGGSAALGGSGSGADQVRRYRTAFTREQIARLEKEFYRENYVSRPRRCELAAALNLPETTIKVWFQNRRMKDKRQRLAMSWPHPADPSFYTYMMTHAAATGSLPYPFHSHVPLHYYPHVGVTAAAAAAAASGAAAAASSPFATSIRPLDTFRALSHPYSRPELLCSFRHPGLYQAPAAAAGLNSAASAAAAAAAAAAAASSAAAAGAPPSGGSAPCSCLSCHSSQSAAAAAAAAAAALGSRGGGGGGGGGGGGGGGGAGAGGGSDFGCSAAAPRSESGFLPYSAAVLSKTAVSPPDQRDEAPLTR
"
     misc_feature    751..927
                     /gene="EVX2"
                     /gene_synonym="EVX-2"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(751..765,769..771,820..822,838..840,877..879,
                     883..888,895..900,904..912,916..921)
                     /gene="EVX2"
                     /gene_synonym="EVX-2"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(757..759,766..768,886..888,895..900,907..909)
                     /gene="EVX2"
                     /gene_synonym="EVX-2"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     exon            614..885
                     /gene="EVX2"
                     /gene_synonym="EVX-2"
                     /inference="alignment:Splign:1.39.8"
     exon            886..1617
                     /gene="EVX2"
                     /gene_synonym="EVX-2"
                     /inference="alignment:Splign:1.39.8"
     variation       1440
                     /gene="EVX2"
                     /gene_synonym="EVX-2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1868101"
ORIGIN      
aggatgtatgggtcattttgaccagtcattccctcgctctggcatcccacaatttttccgcctccctccgaaagcgataataatatttagaggcgttcgctggggctgaatgagaattagccctaggcgcagcctatcattaggacgggacagcagggccactgtgacatttttaagaaagctgagatgatggaaagaataagaaaagagatgattctgatggagagagggctgcacagccctacggcgggcaagagattctccaatttgtccaactcggctggcaatgctgtgctcgaggccctggaaaattcgcagcacccggctcgcctaagcccgcgcctgccgtctgcccccctgcacagcgctctgggagaactccccgccaagggcaaattcgaaatagacactttgttcaacctgcagcacacgggcagcgaaagcaccgtctcctccgaaatctcctccgccgccgagagccgcaagaagccgggccattattcagaggcggccgctgaggccgacatgagcagcgacgtggaggtgggctgctccgcgcttcgctcccccgggggcctcggcgccgctcagcttaaggaaaacaatggcaaagggtacgcagagagcggctcggctgccggcaccacgacgtcggcgtcgggctcaggcctcggaagcctgcatggaggcagcggaggcagcggcgggagcgcggcgctgggtggctccggctctggcgcggatcaagtgcggcgctaccgtacggcgttcacccgcgagcagatcgcgcgcctggagaaggagttctaccgggagaactatgtgtcgcggccccgccggtgcgagctggccgcggcactcaacctgcccgaaaccaccatcaaggtgtggttccagaaccggcgcatgaaggacaagcggcagcgcctggccatgtcctggccgcacccagccgaccccagcttctacacctacatgatgacgcacgcggccgccaccggaagcctgccctaccccttccactcgcacgtgccgctgcactactacccgcacgtgggcgtcacggcggcggcggccgcggctgcagcctcaggcgcggcggccgcggcttcgtcgcccttcgctacttccatccggccactggacaccttccgcgccctctcgcacccctactctcggccggagctgctgtgtagcttccgccaccctggtctctaccaggctcccgcggccgccgcggggctcaacagcgcggcctctgccgcggcagccgcggcagccgcagcggctgcggcctcctcggcggcggcggccggcgcgccccccagcggcggctctgcaccctgctcgtgcctcagttgccacagcagtcagtcggcggcggcagccgcggcagcagctgccgcagccctgggttcccggggtggcggtggcggcggcggtggtggtggtggcggcggcggcgggggcgccggggccgggggaggctcggacttcggctgcagcgcggcggcgccgcgttccgagagcggcttcctgccctactcggccgcggtgcttagtaagacggccgtgagcccgccggaccagagggacgaggctccgctcaccagataa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:344191 -> Molecular function: GO:0003677 [DNA binding] evidence: NAS
            GeneID:344191 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA
            GeneID:344191 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
            GeneID:344191 -> Biological process: GO:0008150 [biological_process] evidence: ND
            GeneID:344191 -> Biological process: GO:0035108 [limb morphogenesis] evidence: IEA
            GeneID:344191 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:344191 -> Cellular component: GO:0005634 [nucleus] evidence: NAS
            GeneID:344191 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.