LOCUS       NM_001080413            2076 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens NOBOX oogenesis homeobox (NOBOX), mRNA.
ACCESSION   NM_001080413 XM_001134420
VERSION     NM_001080413.3  GI:333470750
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2076)
  AUTHORS   Bouilly,J., Bachelot,A., Broutin,I., Touraine,P. and Binart,N.
  TITLE     Novel NOBOX loss-of-function mutations account for 6.2% of cases in
            a large primary ovarian insufficiency cohort
  JOURNAL   Hum. Mutat. 32 (10), 1108-1113 (2011)
   PUBMED   21837770
  REMARK    GeneRIF: The very high 6.2% prevalence of these new mutations in
            POI patients suggest considering NOBOX as the first autosomal
            candidate gene involved in this syndrome.
REFERENCE   2  (bases 1 to 2076)
  AUTHORS   Brauner,R., Bashamboo,A., Rouget,S., Goulet,M., Philibert,P.,
            Sarda-Thibault,H., Trivin,C., Misrahi,M., Sultan,C. and
            McElreavey,K.
  TITLE     Clinical, biological and genetic analysis of prepubertal isolated
            ovarian cyst in 11 girls
  JOURNAL   PLoS ONE 5 (6), E11282 (2010)
   PUBMED   20593028
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 2076)
  AUTHORS   van Dooren,M.F., Bertoli-Avellab,A.M. and Oldenburg,R.A.
  TITLE     Premature ovarian failure and gene polymorphisms
  JOURNAL   Curr. Opin. Obstet. Gynecol. 21 (4), 313-317 (2009)
   PUBMED   19610175
  REMARK    Review article
REFERENCE   4  (bases 1 to 2076)
  AUTHORS   Qin,Y., Shi,Y., Zhao,Y., Carson,S.A., Simpson,J.L. and Chen,Z.J.
  TITLE     Mutation analysis of NOBOX homeodomain in Chinese women with
            premature ovarian failure
  JOURNAL   Fertil. Steril. 91 (4 SUPPL), 1507-1509 (2009)
   PUBMED   18930203
  REMARK    GeneRIF: Mutations in the homeobox domain of NOBOX are not common
            explanations for POF in Chinese women.
            GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   5  (bases 1 to 2076)
  AUTHORS   Oldenburg,R.A., van Dooren,M.F., de Graaf,B., Simons,E.,
            Govaerts,L., Swagemakers,S., Verkerk,J.M., Oostra,B.A. and
            Bertoli-Avella,A.M.
  TITLE     A genome-wide linkage scan in a Dutch family identifies a premature
            ovarian failure susceptibility locus
  JOURNAL   Hum. Reprod. 23 (12), 2835-2841 (2008)
   PUBMED   18689850
REFERENCE   6  (bases 1 to 2076)
  AUTHORS   Huntriss,J., Hinkins,M. and Picton,H.M.
  TITLE     cDNA cloning and expression of the human NOBOX gene in oocytes and
            ovarian follicles
  JOURNAL   Mol. Hum. Reprod. 12 (5), 283-289 (2006)
   PUBMED   16597639
  REMARK    GeneRIF: NOBOX expression within adult human tissues is limited to
            the testis, pancreas and oocyte specific in ovary.
REFERENCE   7  (bases 1 to 2076)
  AUTHORS   Zhao,X.X., Suzumori,N., Yamaguchi,M. and Suzumori,K.
  TITLE     Mutational analysis of the homeobox region of the human NOBOX gene
            in Japanese women who exhibit premature ovarian failure
  JOURNAL   Fertil. Steril. 83 (6), 1843-1844 (2005)
   PUBMED   15950662
  REMARK    GeneRIF: Mutations of the homeobox region of the NOBOX gene are
            uncommon in Japanese patients with premature ovarian failure.
REFERENCE   8  (bases 1 to 2076)
  AUTHORS   Rajkovic,A., Pangas,S.A., Ballow,D., Suzumori,N. and Matzuk,M.M.
  TITLE     NOBOX deficiency disrupts early folliculogenesis and
            oocyte-specific gene expression
  JOURNAL   Science 305 (5687), 1157-1159 (2004)
   PUBMED   15326356
REFERENCE   9  (bases 1 to 2076)
  AUTHORS   Suzumori,N., Yan,C., Matzuk,M.M. and Rajkovic,A.
  TITLE     Nobox is a homeobox-encoding gene preferentially expressed in
            primordial and growing oocytes
  JOURNAL   Mech. Dev. 111 (1-2), 137-141 (2002)
   PUBMED   11804785
REFERENCE   10 (bases 1 to 2076)
  AUTHORS   Rovescalli,A.C., Asoh,S. and Nirenberg,M.
  TITLE     Cloning and characterization of four murine homeobox genes
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 93 (20), 10691-10696 (1996)
   PUBMED   8855241
  REMARK    Erratum:[Proc Natl Acad Sci U S A 1996 Dec 24;93(26):15522]
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC004534.1.
            This sequence is a reference standard in the RefSeqGene project.
            On May 20, 2011 this sequence version replaced gi:269784634.
            
            Summary: This homeobox gene encodes a transcription factor that is
            thought to play a role in oogenesis. In mice, it is essential for
            folliculogenesis and regulation of oocyte-specific genes. Defects
            in this gene result in premature ovarian failure type 5.[provided
            by RefSeq, May 2011].
            
            Sequence Note: The RefSeq transcript and protein were assembled by
            in silico methods based on partial sequence data reported in PMID:
            16597639 and additional support from similarity to mouse protein
            NP_570939.1. The 5' and 3' exons have not been experimentally
            verified in humans.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support ERS025085
                              [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-85                AC004534.1         65518-65602         c
            86-210              AC004534.1         59931-60055         c
            211-292             AC004534.1         57244-57325         c
            293-844             AC004534.1         56421-56972         c
            845-1047            AC004534.1         55485-55687         c
            1048-1154           AC004534.1         55132-55238         c
            1155-1240           AC004534.1         54772-54857         c
            1241-1469           AC004534.1         54325-54553         c
            1470-1774           AC004534.1         53657-53961         c
            1775-2076           AC004534.1         52615-52916         c
FEATURES             Location/Qualifiers
     source          1..2076
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="7"
                     /map="7q35"
     gene            1..2076
                     /gene="NOBOX"
                     /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042"
                     /note="NOBOX oogenesis homeobox"
                     /db_xref="GeneID:135935"
                     /db_xref="HGNC:22448"
                     /db_xref="MIM:610934"
     CDS             1..2076
                     /gene="NOBOX"
                     /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042"
                     /note="newborn ovary homeobox-encoding"
                     /codon_start=1
                     /product="homeobox protein NOBOX"
                     /protein_id="NP_001073882.3"
                     /db_xref="GI:333470751"
                     /db_xref="GeneID:135935"
                     /db_xref="HGNC:22448"
                     /db_xref="MIM:610934"
                     /translation="

MALLLTLTSPDLEGTWDTRDKDGFKAQEGPPLAVPEFPVCGLYRIYGVCGSFSSFFIIRCSLCALETLKSPQHDPLEIPEQSLKLIPLVSGKRELTRGQKAGEKPLAAGPGEEELLRGSAPHAQDTQSEELPPSCTISGEKKPPAVSGEATGADAGRLCPPPRSRAPHKDRTLARSRPQTQGEDCSLPVGEVKIGKRSYSPAPGKQKKPNAMGLAPTSSPGAPNSARATHNPVPCGSGRGPCHLANLLSTLAQSNQNRDHKQGPPEVTCQIRKKTRTLYRSDQLEELEKIFQEDHYPDSDKRREIAQTVGVTPQRIMVKGAGSLVAGWSGGGPTIETLELQSERSAVAWVWFQNRRAKWRKMEKLNGKESKDNPAAPGPASSQCSSAAEILPAVPMEPKPDPFPQESPLDTFPEPPMLLTSDQTLAPTQPSEGAQRVVTPPLFSPPPVRRADLPFPLGPVHTPQLMPLLMDVAGSDSSHKDGPCGSWGTSITLPPPCSYLEELEPQDYQQSNQPGPFQFSQAPQPPLFQSPQPKLPYLPTFPFSMPSSLTLPPPEDSLFMFPCGPSGGTSQGYCPGASSGQILMQPPAGNIGTASWSDPCLPELPFPGPFCPQALGHPPGGDGYFPDLFPTPCPQALGRQPSSALSWMPEGARPGTGPLLSKAKEEPPAASLDQPSALEEARGDDKNSHVP

"
     misc_feature    817..1089
                     /gene="NOBOX"
                     /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(817..831,835..837,886..888,904..906,943..945,
                     949..951,1048..1050,1057..1062,1066..1074,1078..1083)
                     /gene="NOBOX"
                     /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(823..825,832..834,1048..1050,1057..1062,1069..1071)
                     /gene="NOBOX"
                     /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     misc_feature    <1120..1590
                     /gene="NOBOX"
                     /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042"
                     /note="Herpesvirus transcription activation factor
                     (transactivator); Region: Herpes_TAF50; pfam03326"
                     /db_xref="CDD:112154"
     exon            1..85
                     /gene="NOBOX"
                     /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042"
                     /inference="alignment:Splign:1.39.8"
     exon            86..210
                     /gene="NOBOX"
                     /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042"
                     /inference="alignment:Splign:1.39.8"
     variation       126
                     /gene="NOBOX"
                     /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2003479"
     exon            211..292
                     /gene="NOBOX"
                     /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042"
                     /inference="alignment:Splign:1.39.8"
     exon            293..844
                     /gene="NOBOX"
                     /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042"
                     /inference="alignment:Splign:1.39.8"
     exon            845..1047
                     /gene="NOBOX"
                     /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042"
                     /inference="alignment:Splign:1.39.8"
     exon            1048..1154
                     /gene="NOBOX"
                     /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042"
                     /inference="alignment:Splign:1.39.8"
     exon            1155..1240
                     /gene="NOBOX"
                     /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042"
                     /inference="alignment:Splign:1.39.8"
     exon            1241..1469
                     /gene="NOBOX"
                     /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042"
                     /inference="alignment:Splign:1.39.8"
     exon            1470..1774
                     /gene="NOBOX"
                     /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042"
                     /inference="alignment:Splign:1.39.8"
     variation       1549
                     /gene="NOBOX"
                     /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2699503"
     exon            1775..2076
                     /gene="NOBOX"
                     /gene_synonym="OG-2; OG2; OG2X; POF5; TCAG_12042"
                     /inference="alignment:Splign:1.39.8"
ORIGIN      

atggctctccttttgacactaacatcaccagacctggagggtacctgggacaccagagacaaggatggcttcaaagcccaggaggggccgcccctggctgtacctgaatttcctgtgtgtggactgtaccggatctacggagtctgtggctctttcagctccttcttcatcatccggtgcagcctttgtgctctggagaccctcaaatcaccccaacatgatcccttagagatacctgaacagtccctcaaactcatacccctggtgtctgggaaaagggaactcacaaggggccagaaagctggagagaagcccctggctgcaggacccggggaggaggaactgctccggggctcagcccctcatgctcaggacactcagagtgaggaactgccaccctcctgcaccatctcaggagagaagaagccgccagcagtctctggagaagccaccggggctgatgctgggagactgtgcccgcccccccgctccagggctccccacaaagacagaactctagcccgctccaggccccagactcagggggaagattgttccctcccagtgggagaggtgaagataggaaagaggtcctattctccagcccccgggaagcagaaaaagcctaatgccatgggtctggccccaacatcatctccgggtgcccctaactcagcccgtgccacacacaacccagtgccctgtgggtcaggccgggggccctgccacctggccaatctcctcagtacattggcgcagagcaaccaaaacagagaccacaagcaggggcccccggaagtgacctgccaaattaggaaaaagacacgaaccctataccgctcagatcagctggaggagctagagaagatattccaagaagaccactatcctgacagtgataaacgccgagagattgcccagacggtgggggtgaccccccagcgcatcatggtaaagggggccggctcactggtggcagggtggagtggcggagggcccaccattgaaacactcgaattgcagagtgagcgctcagcggtagcctgggtgtggttccagaatcgccgggccaagtggcgaaaaatggagaaactgaatgggaaagaaagcaaggacaatcctgcagcccctggccctgccagcagtcaatgcagctctgcagctgagatcctacctgctgtgcccatggagccaaagcctgaccctttccctcaggagtcccctctggatacctttccagagccccccatgctgctgacttctgaccagactttggcccccacccaacccagtgagggtgctcagagggtggtgacccccccactcttcagccccccacctgtgcgaagggccgatcttcctttcccccttggccctgtccacaccccccaactgatgccactgctgatggatgttgctggcagtgacagcagccacaaggacggcccctgtgggtcctgggggacaagcatcaccctgccacccccctgttcatatttggaggagctggagccccaggattaccaacagagcaaccagccaggacccttccagttctcccaggctccacagcccccgcttttccagtcccctcagcccaagttgccctacctccccactttccccttctccatgcccagttcactgacgcttccaccgcccgaagactctctctttatgtttccctgtggccccagcgggggcacatcgcagggctattgcccaggtgcctcctcaggacagatcctgatgcaaccacctgctgggaatataggtacagcctcctggagtgacccctgtttgccagagctgcccttccctggtccgttctgcccacaagctctggggcatcccccaggaggggatggctactttcctgatctatttccaactccctgcccccaggctctgggcaggcagccttcgtcagctctctcatggatgcctgaaggggccagaccagggactgggcccttactcagcaaggcaaaagaggaaccaccagctgcttccctggatcagccctcagcactggaggaggccagaggggatgacaagaatagccatgtcccctag

//

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:135935 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA
            GeneID:135935 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
            GeneID:135935 -> Biological process: GO:0001541 [ovarian follicle development] evidence: IEA
            GeneID:135935 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
            GeneID:135935 -> Biological process: GO:0030154 [cell differentiation] evidence: IEA
            GeneID:135935 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IEA
            GeneID:135935 -> Biological process: GO:0048477 [oogenesis] evidence: IEA
            GeneID:135935 -> Cellular component: GO:0005634 [nucleus] evidence: IEA