GGRNA | NM_001037802.1

LOCUS       NM_001037802             891 bp    mRNA    linear   PRI 08-MAY-2013
DEFINITION  Homo sapiens SKI family transcriptional corepressor 2 (SKOR2),
            transcript variant 2, mRNA.
ACCESSION   NM_001037802 XM_930005 XM_938292
VERSION     NM_001037802.1  GI:83699421
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 891)
  AUTHORS   Elks,C.E., Perry,J.R., Sulem,P., Chasman,D.I., Franceschini,N.,
            He,C., Lunetta,K.L., Visser,J.A., Byrne,E.M., Cousminer,D.L.,
            Gudbjartsson,D.F., Esko,T., Feenstra,B., Hottenga,J.J.,
            Koller,D.L., Kutalik,Z., Lin,P., Mangino,M., Marongiu,M.,
            McArdle,P.F., Smith,A.V., Stolk,L., van Wingerden,S.H., Zhao,J.H.,
            Albrecht,E., Corre,T., Ingelsson,E., Hayward,C., Magnusson,P.K.,
            Smith,E.N., Ulivi,S., Warrington,N.M., Zgaga,L., Alavere,H.,
            Amin,N., Aspelund,T., Bandinelli,S., Barroso,I., Berenson,G.S.,
            Bergmann,S., Blackburn,H., Boerwinkle,E., Buring,J.E., Busonero,F.,
            Campbell,H., Chanock,S.J., Chen,W., Cornelis,M.C., Couper,D.,
            Coviello,A.D., d'Adamo,P., de Faire,U., de Geus,E.J., Deloukas,P.,
            Doring,A., Smith,G.D., Easton,D.F., Eiriksdottir,G., Emilsson,V.,
            Eriksson,J., Ferrucci,L., Folsom,A.R., Foroud,T., Garcia,M.,
            Gasparini,P., Geller,F., Gieger,C., Gudnason,V., Hall,P.,
            Hankinson,S.E., Ferreli,L., Heath,A.C., Hernandez,D.G., Hofman,A.,
            Hu,F.B., Illig,T., Jarvelin,M.R., Johnson,A.D., Karasik,D.,
            Khaw,K.T., Kiel,D.P., Kilpelainen,T.O., Kolcic,I., Kraft,P.,
            Launer,L.J., Laven,J.S., Li,S., Liu,J., Levy,D., Martin,N.G.,
            McArdle,W.L., Melbye,M., Mooser,V., Murray,J.C., Murray,S.S.,
            Nalls,M.A., Navarro,P., Nelis,M., Ness,A.R., Northstone,K.,
            Oostra,B.A., Peacock,M., Palmer,L.J., Palotie,A., Pare,G.,
            Parker,A.N., Pedersen,N.L., Peltonen,L., Pennell,C.E., Pharoah,P.,
            Polasek,O., Plump,A.S., Pouta,A., Porcu,E., Rafnar,T., Rice,J.P.,
            Ring,S.M., Rivadeneira,F., Rudan,I., Sala,C., Salomaa,V., Sanna,S.,
            Schlessinger,D., Schork,N.J., Scuteri,A., Segre,A.V.,
            Shuldiner,A.R., Soranzo,N., Sovio,U., Srinivasan,S.R.,
            Strachan,D.P., Tammesoo,M.L., Tikkanen,E., Toniolo,D., Tsui,K.,
            Tryggvadottir,L., Tyrer,J., Uda,M., van Dam,R.M., van Meurs,J.B.,
            Vollenweider,P., Waeber,G., Wareham,N.J., Waterworth,D.M.,
            Weedon,M.N., Wichmann,H.E., Willemsen,G., Wilson,J.F., Wright,A.F.,
            Young,L., Zhai,G., Zhuang,W.V., Bierut,L.J., Boomsma,D.I.,
            Boyd,H.A., Crisponi,L., Demerath,E.W., van Duijn,C.M., Econs,M.J.,
            Harris,T.B., Hunter,D.J., Loos,R.J., Metspalu,A., Montgomery,G.W.,
            Ridker,P.M., Spector,T.D., Streeten,E.A., Stefansson,K.,
            Thorsteinsdottir,U., Uitterlinden,A.G., Widen,E., Murabito,J.M.,
            Ong,K.K. and Murray,A.
  CONSRTM   GIANT Consortium
  TITLE     Thirty new loci for age at menarche identified by a meta-analysis
            of genome-wide association studies
  JOURNAL   Nat. Genet. 42 (12), 1077-1085 (2010)
   PUBMED   21102462
REFERENCE   2  (bases 1 to 891)
  AUTHORS   Bennett,K.L., Lee,W., Lamarre,E., Zhang,X., Seth,R., Scharpf,J.,
            Hunt,J. and Eng,C.
  TITLE     HPV status-independent association of alcohol and tobacco exposure
            or prior radiation therapy with promoter methylation of FUSSEL18,
            EBF3, IRX1, and SEPT9, but not SLC5A8, in head and neck squamous
            cell carcinomas
  JOURNAL   Genes Chromosomes Cancer 49 (4), 319-326 (2010)
   PUBMED   20029986
  REMARK    GeneRIF: Results verify IRX1, EBF3, SLC5A8, SEPT9, and FUSSEL18 as
            valid methylation markers in two separate sets of HNSCC specimens;
            also preliminarily show a trend between HPV16 positivity and target
            gene hypermethylation of IRX1, EBF3, SLC5A8, and SEPT9.
REFERENCE   3  (bases 1 to 891)
  AUTHORS   Minaki,Y., Nakatani,T., Mizuhara,E., Inoue,T. and Ono,Y.
  TITLE     Identification of a novel transcriptional corepressor, Corl2, as a
            cerebellar Purkinje cell-selective marker
  JOURNAL   Gene Expr. Patterns 8 (6), 418-423 (2008)
   PUBMED   18522874
  REMARK    GeneRIF: Experiments performed using mice, but the observations
            maybe relevant to other organisms as well.
REFERENCE   4  (bases 1 to 891)
  AUTHORS   Arndt,S., Poser,I., Schubert,T., Moser,M. and Bosserhoff,A.K.
  TITLE     Cloning and functional characterization of a new Ski homolog,
            Fussel-18, specifically expressed in neuronal tissues
  JOURNAL   Lab. Invest. 85 (11), 1330-1341 (2005)
   PUBMED   16200078
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AY669508.1.
            On or before Apr 7, 2006 this sequence version replaced
            gi:89047184, gi:89047459.
            
            Transcript Variant: This variant (2) uses an alternate donor splice
            site in the 5' coding region, lacks several exons, and contains an
            alternate 3' terminal exon compared to variant 1. The 5' region
            differences result in a frame-shift, and a shorter isoform (2, also
            known as FUSSEL18) with a distinct C-terminus compared to isoform
            1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AY669508.1 [ECO:0000332]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..891
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="18"
                     /map="18q21.1"
     gene            1..891
                     /gene="SKOR2"
                     /gene_synonym="CORL2; FUSSEL18"
                     /note="SKI family transcriptional corepressor 2"
                     /db_xref="GeneID:652991"
                     /db_xref="HGNC:32695"
     CDS             1..891
                     /gene="SKOR2"
                     /gene_synonym="CORL2; FUSSEL18"
                     /note="isoform 2 is encoded by transcript variant 2;
                     functional smad suppressing element 18; ladybird homeobox
                     corepressor 1-like protein; fussel-18; LBX1 corepressor
                     1-like protein; functional Smad-suppressing element on
                     chromosome 18"
                     /codon_start=1
                     /product="SKI family transcriptional corepressor 2 isoform
                     2"
                     /protein_id="NP_001032891.1"
                     /db_xref="GI:83699422"
                     /db_xref="GeneID:652991"
                     /db_xref="HGNC:32695"
                     /translation="

MASSPLPGPNDILLASPSSAFQPDTLSQPRPGHANLKPNQVGQVILYGIPIVSLVIDGQERLCLAQISNTLLKNFSYNEIHNRRVALGITCVQCTPVQLEILRRAGAMPISSRRCGMITKREAERLCKSFLGENRPPKLPDNFAFDVSHECAWGCRGSFIPARYNSSRAKCIKCSYCNMYFSPNKFIFHSHRTPDAKYTQPDAANFNSWRRHLKLTDKSPQDELVFAWEDVKAMFNGGSRKRALPQPGAHPACHPLSSIRTRSIAFSSQTLMLLEEIFGEKDQEDYMRINEDNIWL

"
     misc_feature    100..399
                     /gene="SKOR2"
                     /gene_synonym="CORL2; FUSSEL18"
                     /note="SKI/SNO/DAC family; Region: Ski_Sno; pfam02437"
                     /db_xref="CDD:145533"
     misc_feature    430..708
                     /gene="SKOR2"
                     /gene_synonym="CORL2; FUSSEL18"
                     /note="c-SKI Smad4 binding domain; Region:
                     c-SKI_SMAD_bind; smart01046"
                     /db_xref="CDD:198114"
     exon            1..774
                     /gene="SKOR2"
                     /gene_synonym="CORL2; FUSSEL18"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(57)
                     /gene="SKOR2"
                     /gene_synonym="CORL2; FUSSEL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376817644"
     STS             101..623
                     /gene="SKOR2"
                     /gene_synonym="CORL2; FUSSEL18"
                     /standard_name="Fussel18"
                     /db_xref="UniSTS:497289"
     variation       complement(345)
                     /gene="SKOR2"
                     /gene_synonym="CORL2; FUSSEL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371202595"
     variation       complement(431)
                     /gene="SKOR2"
                     /gene_synonym="CORL2; FUSSEL18"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376365161"
     variation       complement(527)
                     /gene="SKOR2"
                     /gene_synonym="CORL2; FUSSEL18"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:202063106"
     variation       complement(702)
                     /gene="SKOR2"
                     /gene_synonym="CORL2; FUSSEL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373929593"
     variation       complement(713)
                     /gene="SKOR2"
                     /gene_synonym="CORL2; FUSSEL18"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:188936589"
     exon            775..849
                     /gene="SKOR2"
                     /gene_synonym="CORL2; FUSSEL18"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(828)
                     /gene="SKOR2"
                     /gene_synonym="CORL2; FUSSEL18"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189508010"
     variation       complement(833)
                     /gene="SKOR2"
                     /gene_synonym="CORL2; FUSSEL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:185081406"
     exon            850..891
                     /gene="SKOR2"
                     /gene_synonym="CORL2; FUSSEL18"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(885)
                     /gene="SKOR2"
                     /gene_synonym="CORL2; FUSSEL18"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:368852477"
ORIGIN

atggcttccagtccgctgccagggcccaacgacatcctgctggcgtcgccgtcgagcgccttccagcccgacacgctgagccagccgcggccagggcacgccaacctcaaacccaaccaggtgggccaggtgatcctctacggcattcccatcgtgtcgttggtgatcgacgggcaagagcgcctgtgcctggcgcagatctccaacactctgctcaagaacttcagctacaacgagatccacaaccgtcgcgtggcactgggcatcacgtgtgtgcagtgcacgccggtgcaactggagatcctgcggcgtgccggggccatgcccatctcatcgcgccgctgcggcatgatcaccaaacgcgaggccgagcgtctgtgcaagtcgttcctgggcgaaaacaggccgcccaagctgccagacaatttcgccttcgacgtgtcacacgagtgcgcctggggctgccgcggcagcttcattcccgcgcgctacaacagctcgcgcgccaagtgcatcaaatgcagctactgcaacatgtacttctcgcccaacaagttcattttccactcccaccgcacgcccgacgccaagtacactcagccagacgcagccaacttcaactcgtggcgccgtcatctcaagctcaccgacaagagtccccaggacgagctggtcttcgcctgggaggacgtcaaggccatgttcaacggcggcagccgcaagcgcgcactgccccagccgggcgcgcaccccgcctgccacccgctcagctctataagaacaaggagcatagctttttcatcacagactctgatgcttctggaggagatttttggagagaaagatcaggaggattatatgcgaataaatgaggacaacatttggttatga

//

Annotations: