Home |
Help |
Advanced search
2025-05-09 19:38:30, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001005214 1125 bp mRNA linear PRI 14-MAY-2013
DEFINITION Homo sapiens leucine rich repeat containing 52 (LRRC52), mRNA.
ACCESSION NM_001005214 XM_496422
VERSION NM_001005214.3 GI:194018473
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1125)
AUTHORS Ehret,G.B., O'Connor,A.A., Weder,A., Cooper,R.S. and Chakravarti,A.
TITLE Follow-up of a major linkage peak on chromosome 1 reveals
suggestive QTLs associated with essential hypertension: GenNet
study
JOURNAL Eur. J. Hum. Genet. 17 (12), 1650-1657 (2009)
PUBMED 19536175
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 2 (bases 1 to 1125)
AUTHORS Cheung,C.L., Chan,B.Y., Chan,V., Ikegawa,S., Kou,I., Ngai,H.,
Smith,D., Luk,K.D., Huang,Q.Y., Mori,S., Sham,P.C. and Kung,A.W.
TITLE Pre-B-cell leukemia homeobox 1 (PBX1) shows functional and possible
genetic association with bone mineral density variation
JOURNAL Hum. Mol. Genet. 18 (4), 679-687 (2009)
PUBMED 19064610
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AK098677.1, BC132983.1 and AA725678.1.
On Jul 10, 2008 this sequence version replaced gi:142377344.
##Evidence-Data-START##
Transcript exon combination :: AK098677.1, BC132981.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025085, ERS025088 [ECO:0000348]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-775 AK098677.1 237-1011
776-1064 BC132983.1 748-1036
1065-1125 AA725678.1 1-61 c
FEATURES Location/Qualifiers
source 1..1125
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="1"
/map="1q24.1"
gene 1..1125
/gene="LRRC52"
/note="leucine rich repeat containing 52"
/db_xref="GeneID:440699"
/db_xref="HGNC:32156"
/db_xref="MIM:615218"
exon 1..678
/gene="LRRC52"
/inference="alignment:Splign:1.39.8"
variation 8
/gene="LRRC52"
/replace="a"
/replace="g"
/db_xref="dbSNP:377447417"
variation 15
/gene="LRRC52"
/replace="g"
/replace="t"
/db_xref="dbSNP:201636701"
variation 18
/gene="LRRC52"
/replace="c"
/replace="t"
/db_xref="dbSNP:370709642"
CDS 57..998
/gene="LRRC52"
/note="leucine-rich repeat-containing protein 52; BK
channel auxilliary gamma subunit LRRC52; BK channel
auxiliary gamma subunit LRRC52"
/codon_start=1
/product="leucine-rich repeat-containing protein 52
precursor"
/protein_id="NP_001005214.2"
/db_xref="GI:194018474"
/db_xref="CCDS:CCDS30930.1"
/db_xref="GeneID:440699"
/db_xref="HGNC:32156"
/db_xref="MIM:615218"
/translation="
MSLASGPGPGWLLFSFGMGLVSGSKCPNNCLCQAQEVICTGKQLTEYPLDIPLNTRRLFLNENRITSLPAMHLGLLSDLVYLDCQNNRIREVMDYTFIGVFKLIYLDLSSNNLTSISPFTFSVLSNLVQLNIANNPHLLSLHKFTFANTTSLRYLDLRNTGLQTLDSAALYHLTTLETLFLSGNPWKCNCSFLDFAIFLIVFHMDPSDDLNATCVEPTELTGWPITRVGNPLRYMCITHLDHKDYIFLLLIGFCIFAAGTVAAWLTGVCAVLYQNTRHKSSEEDEDEAGTRVEVSRRIFQTQTSSVQEFPQLI
"
sig_peptide 57..125
/gene="LRRC52"
/inference="COORDINATES: ab initio prediction:SignalP:4.0"
mat_peptide 126..995
/gene="LRRC52"
/product="Leucine-rich repeat-containing protein 52"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N7C0.2)"
misc_feature 132..221
/gene="LRRC52"
/note="Leucine rich repeat N-terminal domain; Region:
LRRNT; smart00013"
/db_xref="CDD:197468"
misc_feature 216..395
/gene="LRRC52"
/note="Leucine rich repeat; Region: LRR_8; pfam13855"
/db_xref="CDD:206026"
misc_feature 216..281
/gene="LRRC52"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N7C0.2);
Region: LRR 1"
misc_feature 288..353
/gene="LRRC52"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N7C0.2);
Region: LRR 2"
misc_feature 360..542
/gene="LRRC52"
/note="Leucine rich repeat; Region: LRR_8; pfam13855"
/db_xref="CDD:206026"
misc_feature 360..425
/gene="LRRC52"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N7C0.2);
Region: LRR 3"
misc_feature 432..500
/gene="LRRC52"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N7C0.2);
Region: LRR 4"
misc_feature 504..>611
/gene="LRRC52"
/note="Leucine Rich repeats (2 copies); Region: LRR_4;
pfam12799"
/db_xref="CDD:205079"
misc_feature 507..572
/gene="LRRC52"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N7C0.2);
Region: LRR 5"
misc_feature 789..851
/gene="LRRC52"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N7C0.2);
transmembrane region"
variation 63
/gene="LRRC52"
/replace="a"
/replace="c"
/db_xref="dbSNP:374191095"
variation 86
/gene="LRRC52"
/replace="a"
/replace="g"
/db_xref="dbSNP:137987001"
variation 113
/gene="LRRC52"
/replace="a"
/replace="g"
/db_xref="dbSNP:141692696"
variation 164
/gene="LRRC52"
/replace="a"
/replace="t"
/db_xref="dbSNP:200101224"
variation 183
/gene="LRRC52"
/replace="c"
/replace="t"
/db_xref="dbSNP:376485734"
variation 194
/gene="LRRC52"
/replace="a"
/replace="c"
/db_xref="dbSNP:373800156"
variation 200
/gene="LRRC52"
/replace="c"
/replace="g"
/db_xref="dbSNP:139452874"
variation 222
/gene="LRRC52"
/replace="a"
/replace="c"
/db_xref="dbSNP:367686135"
variation 223
/gene="LRRC52"
/replace="a"
/replace="g"
/db_xref="dbSNP:142543958"
variation 233
/gene="LRRC52"
/replace="c"
/replace="t"
/db_xref="dbSNP:148736377"
variation 239
/gene="LRRC52"
/replace="c"
/replace="t"
/db_xref="dbSNP:150814230"
variation 260
/gene="LRRC52"
/replace="a"
/replace="g"
/db_xref="dbSNP:372760189"
variation 265
/gene="LRRC52"
/replace="c"
/replace="t"
/db_xref="dbSNP:376324521"
variation 281
/gene="LRRC52"
/replace="c"
/replace="g"
/db_xref="dbSNP:375094839"
variation 302
/gene="LRRC52"
/replace="a"
/replace="g"
/db_xref="dbSNP:115653001"
variation 319
/gene="LRRC52"
/replace="a"
/replace="g"
/db_xref="dbSNP:367635989"
variation 324
/gene="LRRC52"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:114878977"
variation 325
/gene="LRRC52"
/replace="a"
/replace="g"
/db_xref="dbSNP:374982726"
variation 350
/gene="LRRC52"
/replace="c"
/replace="t"
/db_xref="dbSNP:369144835"
variation 352
/gene="LRRC52"
/replace="a"
/replace="g"
/db_xref="dbSNP:370972088"
variation 353
/gene="LRRC52"
/replace="c"
/replace="g"
/db_xref="dbSNP:114654661"
variation 372
/gene="LRRC52"
/replace="c"
/replace="t"
/db_xref="dbSNP:140364875"
variation 401
/gene="LRRC52"
/replace="c"
/replace="g"
/db_xref="dbSNP:149047999"
variation 416
/gene="LRRC52"
/replace="c"
/replace="t"
/db_xref="dbSNP:373153274"
variation 421
/gene="LRRC52"
/replace="c"
/replace="t"
/db_xref="dbSNP:201605916"
variation 422
/gene="LRRC52"
/replace="a"
/replace="g"
/db_xref="dbSNP:143080110"
variation 423
/gene="LRRC52"
/replace="a"
/replace="g"
/db_xref="dbSNP:376333861"
variation 438
/gene="LRRC52"
/replace="a"
/replace="g"
/db_xref="dbSNP:140229260"
variation 455
/gene="LRRC52"
/replace="c"
/replace="t"
/db_xref="dbSNP:144317602"
variation 458
/gene="LRRC52"
/replace="c"
/replace="g"
/db_xref="dbSNP:138107763"
variation 468
/gene="LRRC52"
/replace="c"
/replace="t"
/db_xref="dbSNP:373088117"
variation 476
/gene="LRRC52"
/replace="a"
/replace="g"
/db_xref="dbSNP:377558727"
variation 536
/gene="LRRC52"
/replace="c"
/replace="t"
/db_xref="dbSNP:145989841"
variation 537
/gene="LRRC52"
/replace="a"
/replace="g"
/db_xref="dbSNP:76618230"
variation 642
/gene="LRRC52"
/replace="a"
/replace="g"
/db_xref="dbSNP:149365089"
exon 679..1122
/gene="LRRC52"
/inference="alignment:Splign:1.39.8"
variation 683
/gene="LRRC52"
/replace="a"
/replace="t"
/db_xref="dbSNP:17407838"
variation 722
/gene="LRRC52"
/replace="a"
/replace="g"
/db_xref="dbSNP:114352970"
variation 735
/gene="LRRC52"
/replace="c"
/replace="t"
/db_xref="dbSNP:151287691"
variation 737
/gene="LRRC52"
/replace="a"
/replace="g"
/db_xref="dbSNP:374391913"
variation 754
/gene="LRRC52"
/replace="a"
/replace="g"
/db_xref="dbSNP:202095448"
variation 759
/gene="LRRC52"
/replace="a"
/replace="g"
/db_xref="dbSNP:201124428"
variation 770
/gene="LRRC52"
/replace="a"
/replace="g"
/db_xref="dbSNP:150046093"
variation 825
/gene="LRRC52"
/replace="a"
/replace="g"
/db_xref="dbSNP:137892314"
variation 851
/gene="LRRC52"
/replace="c"
/replace="t"
/db_xref="dbSNP:368453603"
STS 864..983
/gene="LRRC52"
/standard_name="RH99273"
/db_xref="UniSTS:88251"
variation 876
/gene="LRRC52"
/replace="c"
/replace="g"
/db_xref="dbSNP:371179896"
variation 884
/gene="LRRC52"
/replace="c"
/replace="t"
/db_xref="dbSNP:375410575"
variation 885
/gene="LRRC52"
/replace="c"
/replace="t"
/db_xref="dbSNP:115506989"
variation 921
/gene="LRRC52"
/replace="a"
/replace="g"
/db_xref="dbSNP:150359687"
variation 923
/gene="LRRC52"
/replace="g"
/replace="t"
/db_xref="dbSNP:138375533"
variation 942
/gene="LRRC52"
/replace="g"
/replace="t"
/db_xref="dbSNP:453717"
variation 946
/gene="LRRC52"
/replace="a"
/replace="g"
/db_xref="dbSNP:114914708"
variation 960
/gene="LRRC52"
/replace="a"
/replace="c"
/db_xref="dbSNP:144838654"
variation 965
/gene="LRRC52"
/replace="a"
/replace="g"
/db_xref="dbSNP:148593286"
variation 968
/gene="LRRC52"
/replace="c"
/replace="t"
/db_xref="dbSNP:373601718"
variation 970
/gene="LRRC52"
/replace="c"
/replace="t"
/db_xref="dbSNP:199663208"
variation 971
/gene="LRRC52"
/replace="a"
/replace="g"
/db_xref="dbSNP:151094083"
variation 974
/gene="LRRC52"
/replace="a"
/replace="c"
/db_xref="dbSNP:372080054"
variation 1009
/gene="LRRC52"
/replace="c"
/replace="t"
/db_xref="dbSNP:79060241"
variation 1012
/gene="LRRC52"
/replace="c"
/replace="t"
/db_xref="dbSNP:6676948"
variation 1030
/gene="LRRC52"
/replace="c"
/replace="g"
/db_xref="dbSNP:371535068"
variation 1031
/gene="LRRC52"
/replace="a"
/replace="c"
/db_xref="dbSNP:199604137"
variation 1034
/gene="LRRC52"
/replace="g"
/replace="t"
/db_xref="dbSNP:377227058"
variation 1048
/gene="LRRC52"
/replace="c"
/replace="g"
/db_xref="dbSNP:370106877"
variation 1110..1113
/gene="LRRC52"
/replace=""
/replace="taaa"
/db_xref="dbSNP:372299977"
ORIGIN
gatcagaggacagagcccgcaggaaggtgaaaggagggtggttgtggcttcttactatgtcccttgcttcaggccctggccctgggtggttactcttttcctttggaatggggctggtatcagggtcaaagtgtccaaataattgtctgtgtcaagcccaagaagtaatctgcacagggaagcagttaaccgaatacccccttgacatacccctgaacacccggaggctgttcctgaacgagaacagaatcactagtttgccagcaatgcatctaggactcctcagtgaccttgtttatttggactgtcagaacaaccggattcgagaggtgatggattataccttcatcggggtcttcaaactcatctaccttgacctcagctccaacaacctaacctcgatctccccattcactttctcggtgctcagcaacctggtgcagctgaacattgccaacaaccctcacctgttatcgcttcacaagttcacctttgccaacaccacctctttgaggtacctggacctcagaaataccggcttgcagaccctggacagtgctgccttataccacctcactactctggagaccctgtttctgagtggaaacccctggaagtgcaactgctctttcctggacttcgccatcttcttaatagtgttccatatggacccctcagatgatctaaatgccacatgtgtggagcccacagagctgacagggtggcccatcacccgggtggggaacccactccgatacatgtgcatcacgcacctggaccacaaagactacatcttcctgctgctcatcggcttctgcatcttcgccgcgggaactgtggctgcctggctcacaggtgtgtgtgctgtgctctaccagaacacccgccacaagtcgagtgaagaagatgaggacgaggccgggactagggtggaagtcagccggcggatttttcaaacccagacgagctcggtccaggagttccctcagcttatttagttgccagagaccactatcttatgtgcctcccccaggctccctgctttctctcttgccctccccatcccaccaccttggagctgtcatagagattgaaaccttctagtaaaataaataaaatctcaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:440699 -> Biological process: GO:0006811 [ion transport] evidence: IEA
GeneID:440699 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA
GeneID:440699 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.