2025-06-09 09:17:58, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_000696 2500 bp mRNA linear PRI 17-APR-2013 DEFINITION Homo sapiens aldehyde dehydrogenase 9 family, member A1 (ALDH9A1), mRNA. ACCESSION NM_000696 VERSION NM_000696.3 GI:115387103 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2500) AUTHORS Hendrickson,S.L., Lautenberger,J.A., Chinn,L.W., Malasky,M., Sezgin,E., Kingsley,L.A., Goedert,J.J., Kirk,G.D., Gomperts,E.D., Buchbinder,S.P., Troyer,J.L. and O'Brien,S.J. TITLE Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression JOURNAL PLoS ONE 5 (9), E12862 (2010) PUBMED 20877624 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) Publication Status: Online-Only REFERENCE 2 (bases 1 to 2500) AUTHORS Ehret,G.B., O'Connor,A.A., Weder,A., Cooper,R.S. and Chakravarti,A. TITLE Follow-up of a major linkage peak on chromosome 1 reveals suggestive QTLs associated with essential hypertension: GenNet study JOURNAL Eur. J. Hum. Genet. 17 (12), 1650-1657 (2009) PUBMED 19536175 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 3 (bases 1 to 2500) AUTHORS Saito,A., Kawamoto,M. and Kamatani,N. TITLE Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects JOURNAL J. Hum. Genet. 54 (6), 317-323 (2009) PUBMED 19343046 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 4 (bases 1 to 2500) AUTHORS Cheung,C.L., Chan,B.Y., Chan,V., Ikegawa,S., Kou,I., Ngai,H., Smith,D., Luk,K.D., Huang,Q.Y., Mori,S., Sham,P.C. and Kung,A.W. TITLE Pre-B-cell leukemia homeobox 1 (PBX1) shows functional and possible genetic association with bone mineral density variation JOURNAL Hum. Mol. Genet. 18 (4), 679-687 (2009) PUBMED 19064610 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 5 (bases 1 to 2500) AUTHORS Inada,T., Koga,M., Ishiguro,H., Horiuchi,Y., Syu,A., Yoshio,T., Takahashi,N., Ozaki,N. and Arinami,T. TITLE Pathway-based association analysis of genome-wide screening data suggest that genes associated with the gamma-aminobutyric acid receptor signaling pathway are involved in neuroleptic-induced, treatment-resistant tardive dyskinesia JOURNAL Pharmacogenet. Genomics 18 (4), 317-323 (2008) PUBMED 18334916 REMARK GeneRIF: Observational study of gene-disease association. (HuGE Navigator) REFERENCE 6 (bases 1 to 2500) AUTHORS Lin,S.W., Chen,J.C., Hsu,L.C., Hsieh,C.L. and Yoshida,A. TITLE Human gamma-aminobutyraldehyde dehydrogenase (ALDH9): cDNA sequence, genomic organization, polymorphism, chromosomal localization, and tissue expression JOURNAL Genomics 34 (3), 376-380 (1996) PUBMED 8786138 REFERENCE 7 (bases 1 to 2500) AUTHORS Kikonyogo,A. and Pietruszko,R. TITLE Aldehyde dehydrogenase from adult human brain that dehydrogenates gamma-aminobutyraldehyde: purification, characterization, cloning and distribution JOURNAL Biochem. J. 316 (PT 1), 317-324 (1996) PUBMED 8645224 REFERENCE 8 (bases 1 to 2500) AUTHORS McPherson,J.D., Wasmuth,J.J., Kurys,G. and Pietruszko,R. TITLE Human aldehyde dehydrogenase: chromosomal assignment of the gene for the isozyme that metabolizes gamma-aminobutyraldehyde JOURNAL Hum. Genet. 93 (2), 211-212 (1994) PUBMED 8112751 REFERENCE 9 (bases 1 to 2500) AUTHORS Kurys,G., Shah,P.C., Kikonygo,A., Reed,D., Ambroziak,W. and Pietruszko,R. TITLE Human aldehyde dehydrogenase. cDNA cloning and primary structure of the enzyme that catalyzes dehydrogenation of 4-aminobutyraldehyde JOURNAL Eur. J. Biochem. 218 (2), 311-320 (1993) PUBMED 8269919 REFERENCE 10 (bases 1 to 2500) AUTHORS Kurys,G., Ambroziak,W. and Pietruszko,R. TITLE Human aldehyde dehydrogenase. Purification and characterization of a third isozyme with low Km for gamma-aminobutyraldehyde JOURNAL J. Biol. Chem. 264 (8), 4715-4721 (1989) PUBMED 2925663 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL451074.13 and AF172093.1. This sequence is a reference standard in the RefSeqGene project. On Sep 28, 2006 this sequence version replaced gi:25777738. Summary: This protein belongs to the aldehyde dehydrogenase family of proteins. It has a high activity for oxidation of gamma-aminobutyraldehyde and other amino aldehydes. The enzyme catalyzes the dehydrogenation of gamma-aminobutyraldehyde to gamma-aminobutyric acid (GABA). This isozyme is a tetramer of identical 54-kD subunits. [provided by RefSeq, Jul 2008]. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: BC070030.1, U34252.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025084 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-177 AL451074.13 51414-51590 c 178-1662 AF172093.1 1-1485 1663-2500 AL451074.13 15139-15976 c FEATURES Location/Qualifiers source 1..2500 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="1" /map="1q23.1" gene 1..2500 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /note="aldehyde dehydrogenase 9 family, member A1" /db_xref="GeneID:223" /db_xref="HGNC:412" /db_xref="MIM:602733" exon 1..286 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /inference="alignment:Splign:1.39.8" CDS 106..1662 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /EC_number="1.2.1.3" /EC_number="1.2.1.19" /EC_number="1.2.1.47" /note="gamma-aminobutyraldehyde dehydrogenase; aldehyde dehydrogenase E3 isozyme; aldehyde dehydrogenase (NAD+); R-aminobutyraldehyde dehydrogenase; aldehyde dehydrogenase family 9 member A1" /codon_start=1 /product="4-trimethylaminobutyraldehyde dehydrogenase" /protein_id="NP_000687.3" /db_xref="GI:115387104" /db_xref="CCDS:CCDS1250.2" /db_xref="GeneID:223" /db_xref="HGNC:412" /db_xref="MIM:602733" /translation="
MFLRAGLAALSPLLRSLRPSPVAAMSTGTFVVSQPLNYRGGARVEPADASGTEKAFEPATGRVIATFTCSGEKEVNLAVQNAKAAFKIWSQKSGMERCRILLEAARIIREREDEIATMECINNGKSIFEARLDIDISWQCLEYYAGLAASMAGEHIQLPGGSFGYTRREPLGVCVGIGAWNYPFQIASWKSAPALACGNAMVFKPSPFTPVSALLLAEIYSEAGVPPGLFNVVQGGAATGQFLCQHPDVAKVSFTGSVPTGMKIMEMSAKGIKPVTLELGGKSPLIIFSDCDMNNAVKGALMANFLTQGQVCCNGTRVFVQKEILDKFTEEVVKQTQRIKIGDPLLEDTRMGPLINRPHLERVLGFVKVAKEQGAKVLCGGDIYVPEDPKLKDGYYMRPCVLTNCRDDMTCVKEEIFGPVMSILSFDTEAEVLERANDTTFGLAAGVFTRDIQRAHRVVAELQAGTCFINNYNVSPVELPFGGYKKSGFGRENGRVTIEYYSQLKTVCVEMGDVESAF
" misc_feature 202..1659 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /note="betaine aldehyde dehydrogenase; Provisional; Region: PRK13252" /db_xref="CDD:183918" misc_feature 268..1641 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /note="NAD+-dependent 4-trimethylaminobutyraldehyde dehydrogenase, ALDH family 9A1; Region: ALDH_F9_TMBADH; cd07090" /db_xref="CDD:143409" misc_feature order(382..384,388..390,400..402,409..411,421..423, 430..432,529..531,541..543,562..576,598..600,604..612, 889..891,922..924,988..990,997..999,1006..1011,1108..1110, 1153..1155,1453..1464,1471..1476,1480..1482,1489..1491, 1495..1506,1510..1515,1537..1539,1543..1545,1555..1557, 1561..1563,1570..1572,1576..1578,1612..1629,1633..1638) /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /note="tetrameric interface [polypeptide binding]; other site" /db_xref="CDD:143409" misc_feature order(634..639,643..648,715..717,811..813,865..867, 871..876,883..885,937..945,1039..1041,1348..1350, 1354..1356,1546..1548) /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /note="NAD binding site [chemical binding]; other site" /db_xref="CDD:143409" misc_feature order(646..648,937..939,1030..1032,1039..1041) /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /note="catalytic residues [active]" /db_xref="CDD:143409" exon 287..432 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /inference="alignment:Splign:1.39.8" exon 433..562 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /inference="alignment:Splign:1.39.8" variation 507 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /replace="c" /replace="t" /db_xref="dbSNP:1143659" exon 563..697 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /inference="alignment:Splign:1.39.8" exon 698..894 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /inference="alignment:Splign:1.39.8" variation 767 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /replace="c" /replace="g" /db_xref="dbSNP:1065756" exon 895..1035 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /inference="alignment:Splign:1.39.8" variation 1004 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /replace="c" /replace="t" /db_xref="dbSNP:1143660" variation 1005 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /replace="a" /replace="g" /db_xref="dbSNP:1143661" exon 1036..1224 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /inference="alignment:Splign:1.39.8" STS 1125..1249 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /standard_name="WI-12686" /db_xref="UniSTS:6667" exon 1225..1312 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /inference="alignment:Splign:1.39.8" exon 1313..1454 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /inference="alignment:Splign:1.39.8" exon 1455..1567 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /inference="alignment:Splign:1.39.8" exon 1568..2500 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /inference="alignment:Splign:1.39.8" STS 1867..1990 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /standard_name="D1S3343" /db_xref="UniSTS:8469" variation 2154 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /replace="" /replace="a" /db_xref="dbSNP:4646902" variation 2225 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /replace="a" /replace="g" /db_xref="dbSNP:9164" variation 2279 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /replace="a" /replace="c" /db_xref="dbSNP:12670" variation 2377 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /replace="a" /replace="c" /db_xref="dbSNP:11555775" variation 2443 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" /replace="c" /replace="t" /db_xref="dbSNP:11506" polyA_signal 2469..2474 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" polyA_signal 2474..2479 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" polyA_site 2491 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" polyA_site 2496 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" polyA_site 2500 /gene="ALDH9A1" /gene_synonym="ALDH4; ALDH7; ALDH9; E3; TMABADH" ORIGIN
ctgcccctaaaatctcctagaaccgatcccgcggccccgcccctcccgcggccccgcccctcccgcggcccgtcagcctctgccgcggagctgcgtccgccactcatgtttctccgagcaggcctggccgcgctctccccgcttcttcgcagtcttcggccctctcctgtcgccgccatgagcactggcaccttcgtcgtgtcgcagccgctcaattaccgcggcggggcccgcgtggagccggcggacgcctccggtaccgagaaagctttcgagccagcaaccggccgagtgatagctactttcacatgttcaggagaaaaggaagtaaatttggctgttcaaaatgcaaaggctgcttttaaaatatggagtcaaaaatctggcatggagcgttgccgaatccttttggaggctgccaggataataagggaacgggaggatgaaattgctactatggagtgcatcaacaatggcaagtccatctttgaggcccgcttggacattgacatttcctggcagtgcctggagtattatgcgggcttggctgcatccatggctggtgaacacatccagctcccaggtggatcgtttggttataccagaagagaaccacttggggtatgtgtgggaataggagcatggaactacccctttcagattgcctcttggaagtcggctccagcattagcctgtggtaatgccatggtctttaaaccttctccctttacacctgtttctgcattgctactggctgaaatctacagtgaggctggtgtacctcctgggctcttcaatgtggtgcagggaggggctgccacaggccagtttctgtgtcagcatcccgatgtggccaaagtctccttcactggaagtgtgcccactggcatgaagatcatggagatgtcagctaaaggaatcaaacctgttaccttggaacttggaggcaaatctccactcatcatcttctcagactgtgatatgaacaatgctgtaaagggggcgctgatggccaacttcctcacacaaggccaggtttgctgtaatggcacaagagtatttgtgcagaaagaaattcttgataaatttacagaggaagtggtgaaacagacccaaaggattaaaattggagatccccttctggaagatacaaggatgggtccactcatcaaccgaccacacctggagcgagtccttgggtttgtcaaagtggcaaaggagcagggtgctaaagtgttatgtggtggagatatatatgtacctgaagatcccaaattaaaggatggatattacatgagaccttgtgtattaactaattgcagagacgacatgacctgtgtgaaggaagagatctttgggcctgttatgtccattttatcatttgacactgaagctgaggttctagaaagagccaatgataccacttttggactagcagctggcgtctttaccagggacatccaacgggctcatagagtggtagctgagcttcaggctgggacgtgcttcattaacaactataacgtcagcccagtggagttgccctttggtggatataagaagtcaggatttggcagagagaacggccgtgtgacaatcgaatattattcacagctgaagactgtgtgtgtggagatgggtgatgtggaatctgctttttgaaaacctgcagtgaaacctattgacatggccacgctgtggaatgatgtgaattggccctgtttacagaggcagtacaactgaatgttattttacatccagaattttggcgttcagtataagagaatggttcatgttactctttctctctccatcagcttcctcactgaaaatgtgcattaagtgccttgtagatactaatcaagaaagctgtgattctcctcaaagcgtatttttgtgaaatcttttaagagccagtaacatacttctagagaacaggaaaagagactaggataatacatcttccacacatttggcccactgataatgttaattctctggcgtatttcaaagaacttgttcctggctgatccaagtgcagtggtatttacaactaattgatcacaaccagtttgtagatttctttgttccttctccattcccactgcttcacttgcctagtcttgaagaaaaaaaacaaaaaacaaaaaaaaaccttgttcctttataggttcctggtagaatcagtagagatgatttcagctcattgacatttttttaagctatatccccttgtcattccattgagaaagctgacaactgggatagggaggggattagataatagatggggtcaaattctgtgtgaatgtgaacttgcctagtaagcactttgtctctgttcactactgcgatagaggaaatctatctccctatcttgggtccttgaactacagcctgctgtcttacaccagtggagctaccctttaaatgtacaaattatttgtatgctaatgtaatatggtgaaattaaaataaatcacactgttaattgttttcc
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:223 -> Molecular function: GO:0004028 [3-chloroallyl aldehyde dehydrogenase activity] evidence: TAS GeneID:223 -> Molecular function: GO:0004029 [aldehyde dehydrogenase (NAD) activity] evidence: IDA GeneID:223 -> Molecular function: GO:0019145 [aminobutyraldehyde dehydrogenase activity] evidence: IDA GeneID:223 -> Molecular function: GO:0033737 [1-pyrroline dehydrogenase activity] evidence: IEA GeneID:223 -> Molecular function: GO:0047105 [4-trimethylammoniobutyraldehyde dehydrogenase activity] evidence: IEA GeneID:223 -> Biological process: GO:0006081 [cellular aldehyde metabolic process] evidence: IDA GeneID:223 -> Biological process: GO:0034641 [cellular nitrogen compound metabolic process] evidence: TAS GeneID:223 -> Biological process: GO:0042136 [neurotransmitter biosynthetic process] evidence: IDA GeneID:223 -> Biological process: GO:0042445 [hormone metabolic process] evidence: TAS GeneID:223 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS GeneID:223 -> Biological process: GO:0045329 [carnitine biosynthetic process] evidence: IEA GeneID:223 -> Biological process: GO:0045329 [carnitine biosynthetic process] evidence: TAS GeneID:223 -> Biological process: GO:0055114 [oxidation-reduction process] evidence: IDA GeneID:223 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA GeneID:223 -> Cellular component: GO:0005737 [cytoplasm] evidence: TAS GeneID:223 -> Cellular component: GO:0005739 [mitochondrion] evidence: IEA GeneID:223 -> Cellular component: GO:0005829 [cytosol] evidence: TAS GeneID:223 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA ANNOTATIONS from NCBI Entrez Gene (20130726): NP_000687 -> EC 1.2.1.19 NP_000687 -> EC 1.2.1.3 NP_000687 -> EC 1.2.1.47
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.