LOCUS       NM_000522               2514 bp    mRNA    linear   PRI 06-MAY-2013
DEFINITION  Homo sapiens homeobox A13 (HOXA13), mRNA.
ACCESSION   NM_000522
VERSION     NM_000522.4  GI:171906561
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2514)
  AUTHORS   Ekici,A.B., Strissel,P.L., Oppelt,P.G., Renner,S.P., Brucker,S.,
            Beckmann,M.W. and Strick,R.
  TITLE     HOXA10 and HOXA13 sequence variations in human female genital
            malformations including congenital absence of the uterus and vagina
  JOURNAL   Gene 518 (2), 267-272 (2013)
   PUBMED   23376215
  REMARK    GeneRIF: A total of 14 DNA sequence variations (10 novel and 4
            known) within exonic and untranslated regions were detected in
            HOXA10 and HOXA13 among our cohorts of female genital
            malformations.
REFERENCE   2  (bases 1 to 2514)
  AUTHORS   Doodnath,R., Wride,M. and Puri,P.
  TITLE     The spatio-temporal patterning of Hoxa9 and Hoxa13 in the
            developing zebrafish enteric nervous system
  JOURNAL   Pediatr. Surg. Int. 28 (2), 115-121 (2012)
   PUBMED   21971947
  REMARK    GeneRIF: Hoxa9 and Hoxa13 are involved in the early and organised
            patterning of ENS development in the zebrafish model.
REFERENCE   3  (bases 1 to 2514)
  AUTHORS   Shen,L.Y. and Chen,K.N.
  TITLE     Exploration of target genes of HOXA13 in esophageal squamous cell
            carcinoma cell line
  JOURNAL   Cancer Lett. 312 (1), 18-23 (2011)
   PUBMED   21893383
  REMARK    GeneRIF: Results provide an additional support to a hypothesis that
            HOXA13 might participate in the carcinogenesis of esophageal
            squamous cell carcinoma.
REFERENCE   4  (bases 1 to 2514)
  AUTHORS   Cillo,C., Schiavo,G., Cantile,M., Bihl,M.P., Sorrentino,P.,
            Carafa,V., D' Armiento,M., Roncalli,M., Sansano,S., Vecchione,R.,
            Tornillo,L., Mori,L., De Libero,G., Zucman-Rossi,J. and
            Terracciano,L.
  TITLE     The HOX gene network in hepatocellular carcinoma
  JOURNAL   Int. J. Cancer 129 (11), 2577-2587 (2011)
   PUBMED   21626505
  REMARK    GeneRIF: Overexpression of HOXA13 mRNA is associated with
            hepatocellular carcinoma.
REFERENCE   5  (bases 1 to 2514)
  AUTHORS   Zhang,Y., Larsen,C.A., Stadler,H.S. and Ames,J.B.
  TITLE     Structural basis for sequence specific DNA binding and protein
            dimerization of HOXA13
  JOURNAL   PLoS ONE 6 (8), E23069 (2011)
   PUBMED   21829694
  REMARK    GeneRIF: conclude that the non-conserved residue, V373 is critical
            for structurally recognizing TAA in the major groove, and that
            HOXA13 dimerization is required to activate transcription of target
            genes
REFERENCE   6  (bases 1 to 2514)
  AUTHORS   Mortlock,D.P. and Innis,J.W.
  TITLE     Mutation of HOXA13 in hand-foot-genital syndrome
  JOURNAL   Nat. Genet. 15 (2), 179-180 (1997)
   PUBMED   9020844
REFERENCE   7  (bases 1 to 2514)
  AUTHORS   Apiou,F., Flagiello,D., Cillo,C., Malfoy,B., Poupon,M.F. and
            Dutrillaux,B.
  TITLE     Fine mapping of human HOX gene clusters
  JOURNAL   Cytogenet. Cell Genet. 73 (1-2), 114-115 (1996)
   PUBMED   8646877
REFERENCE   8  (bases 1 to 2514)
  AUTHORS   Scott,M.P.
  TITLE     Vertebrate homeobox gene nomenclature
  JOURNAL   Cell 71 (4), 551-553 (1992)
   PUBMED   1358459
REFERENCE   9  (bases 1 to 2514)
  AUTHORS   McAlpine,P.J. and Shows,T.B.
  TITLE     Nomenclature for human homeobox genes
  JOURNAL   Genomics 7 (3), 460 (1990)
   PUBMED   1973146
REFERENCE   10 (bases 1 to 2514)
  AUTHORS   Acampora,D., D'Esposito,M., Faiella,A., Pannese,M., Migliaccio,E.,
            Morelli,F., Stornaiuolo,A., Nigro,V., Simeone,A. and Boncinelli,E.
  TITLE     The human HOX gene family
  JOURNAL   Nucleic Acids Res. 17 (24), 10385-10402 (1989)
   PUBMED   2574852
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BC075791.1, AC004080.2 and
            BC016712.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Apr 2, 2008 this sequence version replaced gi:84452162.
            
            Summary: In vertebrates, the genes encoding the class of
            transcription factors called homeobox genes are found in clusters
            named A, B, C, and D on four separate chromosomes. Expression of
            these proteins is spatially and temporally regulated during
            embryonic development. This gene is part of the A cluster on
            chromosome 7 and encodes a DNA-binding transcription factor which
            may regulate gene expression, morphogenesis, and differentiation.
            Expansion of a polyalanine tract in the encoded protein can cause
            hand-foot-uterus syndrome, also known as hand-foot-genital
            syndrome. [provided by RefSeq, Jul 2008].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC075791.1, AA160421.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084, ERS025085 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-327               BC075791.1         1-327
            328-328             AC004080.2         73149-73149         c
            329-2054            BC075791.1         329-2054
            2055-2055           AC004080.2         70709-70709         c
            2056-2379           BC075791.1         2056-2379
            2380-2380           AC004080.2         70384-70384         c
            2381-2436           BC075791.1         2381-2436
            2437-2455           AC004080.2         70309-70327         c
            2456-2514           BC016712.1         1417-1475
FEATURES             Location/Qualifiers
     source          1..2514
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="7"
                     /map="7p15.2"
     gene            1..2514
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /note="homeobox A13"
                     /db_xref="GeneID:3209"
                     /db_xref="HGNC:5102"
                     /db_xref="HPRD:00847"
                     /db_xref="MIM:142959"
     exon            1..951
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /inference="alignment:Splign:1.39.8"
     STS             30..1246
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /db_xref="UniSTS:481598"
     CDS             30..1196
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /note="homeo box A13; homeo box 1J; transcription factor
                     HOXA13; homeobox protein HOXA13; homeobox protein Hox-1J"
                     /codon_start=1
                     /product="homeobox protein Hox-A13"
                     /protein_id="NP_000513.2"
                     /db_xref="GI:24497554"
                     /db_xref="CCDS:CCDS5412.1"
                     /db_xref="GeneID:3209"
                     /db_xref="HGNC:5102"
                     /db_xref="HPRD:00847"
                     /db_xref="MIM:142959"
                     /translation="

MTASVLLHPRWIEPTVMFLYDNGGGLVADELNKNMEGAAAAAAAAAAAAAAGAGGGGFPHPAAAAAGGNFSVAAAAAAAAAAAANQCRNLMAHPAPLAPGAASAYSSAPGEAPPSAAAAAAAAAAAAAAAAAASSSGGPGPAGPAGAEAAKQCSPCSAAAQSSSGPAALPYGYFGSGYYPCARMGPHPNAIKSCAQPASAAAAAAFADKYMDTAGPAAEEFSSRAKEFAFYHQGYAAGPYHHHQPMPGYLDMPVVPGLGGPGESRHEPLGLPMESYQPWALPNGWNGQMYCPKEQAQPPHLWKSTLPDVVSHPSDASSYRRGRKKRVPYTKVQLKELEREYATNKFITKDKRRRISATTNLSERQVTIWFQNRRVKEKKVINKLKTTS

"
     misc_feature    <534..701
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /note="Hox protein A13 N terminal; Region: HoxA13_N;
                     pfam12284"
                     /db_xref="CDD:152719"
     misc_feature    996..1166
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(996..1010,1014..1016,1065..1067,1083..1085,
                     1122..1124,1128..1133,1140..1145,1149..1157,1161..1166)
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(1002..1004,1011..1013,1131..1133,1140..1145,
                     1152..1154)
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     variation       176
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35042646"
     variation       386..415
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /replace=""
                     /replace="tgctgccgcggctgccgctgcagccgccgc"
                     /db_xref="dbSNP:34856009"
     variation       389..406
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /replace=""
                     /replace="tgccgcggctgccgctgc"
                     /db_xref="dbSNP:35861510"
     variation       450..451
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /replace=""
                     /replace="aggcgggcc"
                     /db_xref="dbSNP:35599078"
     variation       525
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:34398255"
     STS             532..764
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /standard_name="REN100771"
                     /db_xref="UniSTS:425568"
     variation       533
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34185333"
     STS             545..1009
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /standard_name="Hoxa13"
                     /db_xref="UniSTS:265718"
     variation       662
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:35277569"
     variation       716
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1065462"
     STS             881..1450
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /standard_name="stSG609400"
                     /db_xref="UniSTS:449482"
     STS             903..1018
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /standard_name="Hoxa13"
                     /db_xref="UniSTS:547441"
     STS             921..1015
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /standard_name="Hoxa13"
                     /db_xref="UniSTS:536639"
     exon            952..2514
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /inference="alignment:Splign:1.39.8"
     STS             998..1144
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /standard_name="RH66791"
                     /db_xref="UniSTS:1216"
     variation       1031
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35608915"
     STS             1136..1373
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /standard_name="REN100765"
                     /db_xref="UniSTS:425562"
     STS             1339..1601
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /standard_name="REN100764"
                     /db_xref="UniSTS:425561"
     STS             1456..1648
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /standard_name="stSG609399"
                     /db_xref="UniSTS:449481"
     STS             1564..2303
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /standard_name="ECD05314"
                     /db_xref="UniSTS:286380"
     STS             1578..1810
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /standard_name="REN100763"
                     /db_xref="UniSTS:425560"
     STS             1786..2039
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /standard_name="REN100762"
                     /db_xref="UniSTS:425559"
     STS             2025..2269
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /standard_name="REN100761"
                     /db_xref="UniSTS:425558"
     STS             2244..2482
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /standard_name="REN100760"
                     /db_xref="UniSTS:425557"
     STS             2323..2404
                     /gene="HOXA13"
                     /gene_synonym="HOX1; HOX1J"
                     /standard_name="RH93295"
                     /db_xref="UniSTS:86904"
ORIGIN      

actggggtcttctccatgcggctcgggctatgacagcctccgtgctcctccacccccgctggatcgagcccaccgtcatgtttctctacgacaacggcggcggcctggtggccgacgagctcaacaagaacatggaaggggcggcggcggctgcagcagcggctgcagcggcggcggctgccggggccgggggcgggggcttcccccacccggcggctgcggcggcagggggcaacttctcggtggcggcggcggccgcggctgcggcggcggccgcggccaaccagtgccgcaacctgatggcgcacccggcgcccttggcgccaggagccgcgtccgcctacagcagcgcccccggggaggcgcccccgtcggctgccgccgctgctgccgcggctgccgctgcagccgccgccgccgccgccgcgtcgtcctcgggaggtcccggcccggcgggcccggcgggcgcagaggccgccaagcaatgcagcccctgctcggcagcggcgcagagctcgtcggggcccgcggcgctgccctatggctacttcggcagcggctactacccgtgcgcccgcatgggcccgcaccccaacgccatcaagtcgtgcgcgcagcccgcctcggccgccgccgccgccgccttcgcggacaagtacatggataccgccggcccagctgccgaggagttcagctcccgcgctaaggagttcgccttctaccaccagggctacgcagccgggccttaccaccaccatcagcccatgcctggctacctggatatgccagtggtgccgggcctcgggggccccggcgagtcgcgccacgaacccttgggtcttcccatggaaagctaccagccctgggcgctgcccaacggctggaacggccaaatgtactgccccaaagagcaggcgcagcctccccacctctggaagtccactctgcccgacgtggtctcccatccctcggatgccagctcctataggagggggagaaagaagcgcgtgccttataccaaggtgcaattaaaagaacttgaacgggaatacgccacgaataaattcattactaaggacaaacggaggcggatatcagccacgacgaatctctctgagcggcaggtcacaatctggttccagaacaggagggttaaagagaaaaaagtcatcaacaaactgaaaaccactagttaatggattaaaaatagagcaagaaggcaacttgaagaaacgcttcagaactcgttgctttgcccagataatgataataatgcttaataataattgaagaatgggaaagagaaagagacagagactggcattttcctctcccgaaggagatctctttctctttaatggaatctacaactgttttaaaactttaagaaaggtaaagactgccagttcttccgccaaccccatcagcccagcccgttaaatgtcaaacgtcaacccccaaaatacgcaatttcagataagttacgcagttactgaaatcttgtaagtatttaagtgatcgttacattttaggacactgcgttagatggtaataatctggaagttggttacaaacgcaagaggccattgtaaacatctgcttgtccttcttaggtcgccattccctttgcatgttaagcgtctgctcaggtaaatcttagtgaaattcctaccgttgttgtacgttctgcaaaacattttatgtatagatttagaggggaaacgagaaggtactgaaataatgatcttggaatatttgctgtgaagggagaaagggagagaaaactcttctgaggatcatttgtcttggtagtatagtaaaaccaaccagctgaacctttcaggctacaagagaacccgggtcggtaatgtctttttaagaataatttttaattgcttataacaagcatattttgtggcatttgaactatatttactgctccaatatccgttattttccaaaggattttgtatctttttgaaaatgtttacatcatcagatgatccacagaattcactttatgtgagatctcccgagagtttccatcccaacatgatggactttggtttgaacacaattcgttttttcatttgaattggcatttcccaatatttgctaaacatttgctggagaaatcatttttcttttttcttttttagaaaactcagaatgaaaattcattcccctgaaatatttaggtgtctatattctatattttgatctattaagggattagtatttttccatgtttattgtgttatcagagtgcattagaaagattagtgattcatcttcacagcacatttttaatcaagcagttatttcaaccagcacattcgttttgttcatattcactatagaatgatatcttgtaaataaagacattcagcacactgtgaaaatgtatttgtgcacctgctttttaaatatttctactaaaaatgaaaaaaaaaaacccttagacctgtagatagtgatatcgtaatattaattgttaataaaatagtcactgcc

//

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:3209 -> Molecular function: GO:0003677 [DNA binding] evidence: TAS
            GeneID:3209 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA
            GeneID:3209 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
            GeneID:3209 -> Molecular function: GO:0044212 [transcription regulatory region DNA binding] evidence: IEA
            GeneID:3209 -> Biological process: GO:0001501 [skeletal system development] evidence: TAS
            GeneID:3209 -> Biological process: GO:0001570 [vasculogenesis] evidence: IEA
            GeneID:3209 -> Biological process: GO:0001886 [endothelial cell morphogenesis] evidence: IEA
            GeneID:3209 -> Biological process: GO:0001894 [tissue homeostasis] evidence: IEA
            GeneID:3209 -> Biological process: GO:0003281 [ventricular septum development] evidence: IEA
            GeneID:3209 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
            GeneID:3209 -> Biological process: GO:0030510 [regulation of BMP signaling pathway] evidence: IEA
            GeneID:3209 -> Biological process: GO:0030539 [male genitalia development] evidence: IEA
            GeneID:3209 -> Biological process: GO:0035115 [embryonic forelimb morphogenesis] evidence: IEA
            GeneID:3209 -> Biological process: GO:0043065 [positive regulation of apoptotic process] evidence: IEA
            GeneID:3209 -> Biological process: GO:0045840 [positive regulation of mitosis] evidence: IEA
            GeneID:3209 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IEA
            GeneID:3209 -> Biological process: GO:0048839 [inner ear development] evidence: IEA
            GeneID:3209 -> Biological process: GO:0048844 [artery morphogenesis] evidence: IEA
            GeneID:3209 -> Biological process: GO:0060442 [branching involved in prostate gland morphogenesis] evidence: IEA
            GeneID:3209 -> Biological process: GO:0060847 [endothelial cell fate specification] evidence: IEA
            GeneID:3209 -> Cellular component: GO:0005634 [nucleus] evidence: IEA