GGRNA Home | Help | Advanced search

2025-10-22 06:20:46, GGRNA : RefSeq release 60 (20130726)

LOCUS       NR_029842                 86 bp    RNA     linear   PRI 17-JUL-2013
DEFINITION  Homo sapiens microRNA 301a (MIR301A), microRNA.
ACCESSION   NR_029842
VERSION     NR_029842.1  GI:262206112
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 86)
  AUTHORS   Chen,Z., Chen,L.Y., Dai,H.Y., Wang,P., Gao,S. and Wang,K.
  TITLE     miR-301a promotes pancreatic cancer cell proliferation by directly
            inhibiting Bim expression
  JOURNAL   J. Cell. Biochem. 113 (10), 3229-3235 (2012)
   PUBMED   22628193
  REMARK    GeneRIF: miR-301a promotes pancreatic cancer progression by
            repressing Bim.
REFERENCE   2  (bases 1 to 86)
  AUTHORS   Zhou,P., Jiang,W., Wu,L., Chang,R., Wu,K. and Wang,Z.
  TITLE     miR-301a is a candidate oncogene that targets the homeobox gene Gax
            in human hepatocellular carcinoma
  JOURNAL   Dig. Dis. Sci. 57 (5), 1171-1180 (2012)
   PUBMED   22373864
  REMARK    GeneRIF: MiR-301a is a candidate oncogene that targets the homeobox
            gene Gax in human hepatocellular carcinoma.The upregulated miR-301a
            plays an important role in promoting proliferation, migration, and
            invasion, and in inhibiting apoptosis of HCC cells.
REFERENCE   3  (bases 1 to 86)
  AUTHORS   Patel,N., Tahara,S.M., Malik,P. and Kalra,V.K.
  TITLE     Involvement of miR-30c and miR-301a in immediate induction of
            plasminogen activator inhibitor-1 by placental growth factor in
            human pulmonary endothelial cells
  JOURNAL   Biochem. J. 434 (3), 473-482 (2011)
   PUBMED   21175428
  REMARK    GeneRIF: PlGF-induced PAI-1 expression at early time points is
            post-transcriptionally regulated by two miRNAs, miR-30c and
            miR-301a.
REFERENCE   4  (bases 1 to 86)
  AUTHORS   Cao,G., Huang,B., Liu,Z., Zhang,J., Xu,H., Xia,W., Li,J., Li,S.,
            Chen,L., Ding,H., Zhao,Q., Fan,M., Shen,B. and Shao,N.
  TITLE     Intronic miR-301 feedback regulates its host gene, ska2, in A549
            cells by targeting MEOX2 to affect ERK/CREB pathways
  JOURNAL   Biochem. Biophys. Res. Commun. 396 (4), 978-982 (2010)
   PUBMED   20470754
  REMARK    GeneRIF: blocking of miR-301 in A549 cells leads to a decrease in
            the expression of the host gene, ska2.
REFERENCE   5  (bases 1 to 86)
  AUTHORS   Landgraf,P., Rusu,M., Sheridan,R., Sewer,A., Iovino,N., Aravin,A.,
            Pfeffer,S., Rice,A., Kamphorst,A.O., Landthaler,M., Lin,C.,
            Socci,N.D., Hermida,L., Fulci,V., Chiaretti,S., Foa,R.,
            Schliwka,J., Fuchs,U., Novosel,A., Muller,R.U., Schermer,B.,
            Bissels,U., Inman,J., Phan,Q., Chien,M., Weir,D.B., Choksi,R., De
            Vita,G., Frezzetti,D., Trompeter,H.I., Hornung,V., Teng,G.,
            Hartmann,G., Palkovits,M., Di Lauro,R., Wernet,P., Macino,G.,
            Rogler,C.E., Nagle,J.W., Ju,J., Papavasiliou,F.N., Benzing,T.,
            Lichter,P., Tam,W., Brownstein,M.J., Bosio,A., Borkhardt,A.,
            Russo,J.J., Sander,C., Zavolan,M. and Tuschl,T.
  TITLE     A mammalian microRNA expression atlas based on small RNA library
            sequencing
  JOURNAL   Cell 129 (7), 1401-1414 (2007)
   PUBMED   17604727
REFERENCE   6  (bases 1 to 86)
  AUTHORS   Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
            Enright,A.J.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res. 34 (DATABASE ISSUE), D140-D144 (2006)
   PUBMED   16381832
REFERENCE   7  (bases 1 to 86)
  AUTHORS   Weber,M.J.
  TITLE     New human and mouse microRNA genes found by homology search
  JOURNAL   FEBS J. 272 (1), 59-73 (2005)
   PUBMED   15634332
REFERENCE   8  (bases 1 to 86)
  AUTHORS   Suh,M.R., Lee,Y., Kim,J.Y., Kim,S.K., Moon,S.H., Lee,J.Y.,
            Cha,K.Y., Chung,H.M., Yoon,H.S., Moon,S.Y., Kim,V.N. and Kim,K.S.
  TITLE     Human embryonic stem cells express a unique set of microRNAs
  JOURNAL   Dev. Biol. 270 (2), 488-498 (2004)
   PUBMED   15183728
REFERENCE   9  (bases 1 to 86)
  AUTHORS   Houbaviy,H.B., Murray,M.F. and Sharp,P.A.
  TITLE     Embryonic stem cell-specific MicroRNAs
  JOURNAL   Dev. Cell 5 (2), 351-358 (2003)
   PUBMED   12919684
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AC099850.7.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-86                AC099850.7         113005-113090
FEATURES             Location/Qualifiers
     source          1..86
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="17"
                     /map="17q22"
     gene            1..86
                     /gene="MIR301A"
                     /gene_synonym="MIRN301; MIRN301A"
                     /note="microRNA 301a"
                     /db_xref="GeneID:407027"
                     /db_xref="HGNC:31622"
                     /db_xref="miRBase:MI0000745"
     precursor_RNA   1..86
                     /gene="MIR301A"
                     /gene_synonym="MIRN301; MIRN301A"
                     /product="microRNA 301a"
                     /db_xref="GeneID:407027"
                     /db_xref="HGNC:31622"
                     /db_xref="miRBase:MI0000745"
     exon            1..86
                     /gene="MIR301A"
                     /gene_synonym="MIRN301; MIRN301A"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(9)
                     /gene="MIR301A"
                     /gene_synonym="MIRN301; MIRN301A"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376863738"
     variation       complement(10)
                     /gene="MIR301A"
                     /gene_synonym="MIRN301; MIRN301A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370820064"
     ncRNA           14..35
                     /gene="MIR301A"
                     /gene_synonym="MIRN301; MIRN301A"
                     /ncRNA_class="miRNA"
                     /product="hsa-miR-301a-5p"
                     /db_xref="miRBase:MIMAT0022696"
                     /db_xref="GeneID:407027"
                     /db_xref="HGNC:31622"
                     /db_xref="miRBase:MI0000745"
     variation       complement(36)
                     /gene="MIR301A"
                     /gene_synonym="MIRN301; MIRN301A"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373973284"
     ncRNA           51..73
                     /gene="MIR301A"
                     /gene_synonym="MIRN301; MIRN301A"
                     /ncRNA_class="miRNA"
                     /product="hsa-miR-301a-3p"
                     /db_xref="miRBase:MIMAT0000688"
                     /db_xref="GeneID:407027"
                     /db_xref="HGNC:31622"
                     /db_xref="miRBase:MI0000745"
ORIGIN      


actgctaacgaatgctctgactttattgcactactgtactttacagctagcagtgcaatagtattgtcaaagcatctgaaagcagg
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.