LOCUS       NR_031681                 80 bp    RNA     linear   PRI 17-JUL-2013
DEFINITION  Homo sapiens microRNA 1275 (MIR1275), microRNA.
ACCESSION   NR_031681
VERSION     NR_031681.1  GI:269847408
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 80)
  AUTHORS   Kamboh MI, Barmada MM, Demirci FY, Minster RL, Carrasquillo MM,
            Pankratz VS, Younkin SG, Saykin AJ, Sweet RA, Feingold E, DeKosky
            ST and Lopez OL.
  CONSRTM   Alzheimer's Disease Neuroimaging Initiative
  TITLE     Genome-wide association analysis of age-at-onset in Alzheimer's
            disease
  JOURNAL   Mol. Psychiatry 17 (12), 1340-1346 (2012)
   PUBMED   22005931
REFERENCE   2  (bases 1 to 80)
  AUTHORS   Katsushima,K., Shinjo,K., Natsume,A., Ohka,F., Fujii,M., Osada,H.,
            Sekido,Y. and Kondo,Y.
  TITLE     Contribution of microRNA-1275 to Claudin11 protein suppression via
            a polycomb-mediated silencing mechanism in human glioma stem-like
            cells
  JOURNAL   J. Biol. Chem. 287 (33), 27396-27406 (2012)
   PUBMED   22736761
  REMARK    GeneRIF: Treatment with 3-deazaneplanocin A, an inhibitor of H3K27
            methyltransferase, attenuated CLDN11 induction by serum stimulation
            in parallel with sustained miR-1275 expression
REFERENCE   3  (bases 1 to 80)
  AUTHORS   Morin,R.D., O'Connor,M.D., Griffith,M., Kuchenbauer,F., Delaney,A.,
            Prabhu,A.L., Zhao,Y., McDonald,H., Zeng,T., Hirst,M., Eaves,C.J.
            and Marra,M.A.
  TITLE     Application of massively parallel sequencing to microRNA profiling
            and discovery in human embryonic stem cells
  JOURNAL   Genome Res. 18 (4), 610-621 (2008)
   PUBMED   18285502
  REMARK    Erratum:[Genome Res. 2009 May;19(5):958]
REFERENCE   4  (bases 1 to 80)
  AUTHORS   Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
            Enright,A.J.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res. 34 (DATABASE ISSUE), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AL589941.6.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-80                AL589941.6         62682-62761         c
FEATURES             Location/Qualifiers
     source          1..80
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="6"
                     /map="6"
     gene            1..80
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; MIRN1275"
                     /note="microRNA 1275"
                     /db_xref="GeneID:100302123"
                     /db_xref="HGNC:35346"
                     /db_xref="miRBase:MI0006415"
     precursor_RNA   1..80
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; MIRN1275"
                     /product="microRNA 1275"
                     /db_xref="GeneID:100302123"
                     /db_xref="HGNC:35346"
                     /db_xref="miRBase:MI0006415"
     exon            1..80
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; MIRN1275"
                     /inference="alignment:Splign:1.39.8"
     ncRNA           18..34
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; MIRN1275"
                     /ncRNA_class="miRNA"
                     /product="hsa-miR-1275"
                     /db_xref="miRBase:MIMAT0005929"
                     /db_xref="GeneID:100302123"
                     /db_xref="HGNC:35346"
                     /db_xref="miRBase:MI0006415"
     variation       complement(20)
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; MIRN1275"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:374728385"
     variation       complement(23)
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; MIRN1275"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370361021"
     variation       complement(29)
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; MIRN1275"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377188203"
     variation       complement(32..33)
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; MIRN1275"
                     /replace=""
                     /replace="ggttt"
                     /db_xref="dbSNP:372458638"
     variation       complement(42)
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; MIRN1275"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:76156362"
     variation       complement(46)
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; MIRN1275"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:367662685"
     variation       complement(57)
                     /gene="MIR1275"
                     /gene_synonym="hsa-mir-1275; MIRN1275"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369650791"
ORIGIN      

cctctgtgagaaagggtgtgggggagaggctgtcttgtgtctgtaagtatgccaaacttattttccccaaggcagaggga

//