Home |
Help |
Advanced search
2025-05-12 01:54:07, GGRNA : RefSeq release 60 (20130726)
LOCUS NR_029631 110 bp RNA linear PRI 17-JUL-2013
DEFINITION Homo sapiens microRNA 218-1 (MIR218-1), microRNA.
ACCESSION NR_029631
VERSION NR_029631.1 GI:262206325
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 110)
AUTHORS Venkataraman,S., Birks,D.K., Balakrishnan,I., Alimova,I.,
Harris,P.S., Patel,P.R., Handler,M.H., Dubuc,A., Taylor,M.D.,
Foreman,N.K. and Vibhakar,R.
TITLE MicroRNA 218 acts as a tumor suppressor by targeting multiple
cancer phenotype-associated genes in medulloblastoma
JOURNAL J. Biol. Chem. 288 (3), 1918-1928 (2013)
PUBMED 23212916
REMARK GeneRIF: MiR-218 inhibits medulloblastoma tumor cell phenotype by
targeting multiple oncogenes.
REFERENCE 2 (bases 1 to 110)
AUTHORS Prudnikova,T.Y., Mostovich,L.A., Kashuba,V.I., Ernberg,I.,
Zabarovsky,E.R. and Grigorieva,E.V.
TITLE miRNA-218 contributes to the regulation of D-glucuronyl
C5-epimerase expression in normal and tumor breast tissues
JOURNAL Epigenetics 7 (10), 1109-1114 (2012)
PUBMED 22968430
REMARK GeneRIF: positive correlation between miRNA-218 and GLCE mRNA, and
negative correlation between miRNA-218 and GLCE protein levels in
breast tissues and primary tumors in vivo, supporting a direct
involvement of miRNA-218 in posttranscriptional regulation of GLCE
REFERENCE 3 (bases 1 to 110)
AUTHORS Liu,Y., Yan,W., Zhang,W., Chen,L., You,G., Bao,Z., Wang,Y.,
Wang,H., Kang,C. and Jiang,T.
TITLE MiR-218 reverses high invasiveness of glioblastoma cells by
targeting the oncogenic transcription factor LEF1
JOURNAL Oncol. Rep. 28 (3), 1013-1021 (2012)
PUBMED 22766851
REMARK GeneRIF: miR-218 is involved in the invasive behavior of
glioblastoma cells by targeting LEF1 and blocking the invasive
axis.
REFERENCE 4 (bases 1 to 110)
AUTHORS Li,Q., Zhu,F. and Chen,P.
TITLE miR-7 and miR-218 epigenetically control tumor suppressor genes
RASSF1A and Claudin-6 by targeting HoxB3 in breast cancer
JOURNAL Biochem. Biophys. Res. Commun. 424 (1), 28-33 (2012)
PUBMED 22705304
REMARK GeneRIF: the expression levels of miR-7 and miR-218 were strongly
and reversely associated with HoxB3 expression.
REFERENCE 5 (bases 1 to 110)
AUTHORS He,X., Dong,Y., Wu,C.W., Zhao,Z., Ng,S.S., Chan,F.K., Sung,J.J. and
Yu,J.
TITLE MicroRNA-218 inhibits cell cycle progression and promotes apoptosis
in colon cancer by downregulating BMI1 polycomb ring finger
oncogene
JOURNAL Mol. Med. 18, 1491-1498 (2012)
PUBMED 23255074
REMARK GeneRIF: miR-218 suppressed protein expression of BMI-1 downstream
targets of cyclin-dependent kinase 4, a cell cycle regulator, while
upregulating protein expression of p53.
Publication Status: Online-Only
REFERENCE 6 (bases 1 to 110)
AUTHORS Leite,K.R., Sousa-Canavez,J.M., Reis,S.T., Tomiyama,A.H.,
Camara-Lopes,L.H., Sanudo,A., Antunes,A.A. and Srougi,M.
TITLE Change in expression of miR-let7c, miR-100, and miR-218 from high
grade localized prostate cancer to metastasis
JOURNAL Urol. Oncol. 29 (3), 265-269 (2011)
PUBMED 19372056
REMARK GeneRIF: Down-regulation of miR-218 is associated with prostate
cancer metastasis.
REFERENCE 7 (bases 1 to 110)
AUTHORS Lui,W.O., Pourmand,N., Patterson,B.K. and Fire,A.
TITLE Patterns of known and novel small RNAs in human cervical cancer
JOURNAL Cancer Res. 67 (13), 6031-6043 (2007)
PUBMED 17616659
REFERENCE 8 (bases 1 to 110)
AUTHORS Landgraf,P., Rusu,M., Sheridan,R., Sewer,A., Iovino,N., Aravin,A.,
Pfeffer,S., Rice,A., Kamphorst,A.O., Landthaler,M., Lin,C.,
Socci,N.D., Hermida,L., Fulci,V., Chiaretti,S., Foa,R.,
Schliwka,J., Fuchs,U., Novosel,A., Muller,R.U., Schermer,B.,
Bissels,U., Inman,J., Phan,Q., Chien,M., Weir,D.B., Choksi,R., De
Vita,G., Frezzetti,D., Trompeter,H.I., Hornung,V., Teng,G.,
Hartmann,G., Palkovits,M., Di Lauro,R., Wernet,P., Macino,G.,
Rogler,C.E., Nagle,J.W., Ju,J., Papavasiliou,F.N., Benzing,T.,
Lichter,P., Tam,W., Brownstein,M.J., Bosio,A., Borkhardt,A.,
Russo,J.J., Sander,C., Zavolan,M. and Tuschl,T.
TITLE A mammalian microRNA expression atlas based on small RNA library
sequencing
JOURNAL Cell 129 (7), 1401-1414 (2007)
PUBMED 17604727
REFERENCE 9 (bases 1 to 110)
AUTHORS Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
Enright,A.J.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res. 34 (DATABASE ISSUE), D140-D144 (2006)
PUBMED 16381832
REFERENCE 10 (bases 1 to 110)
AUTHORS Lim,L.P., Glasner,M.E., Yekta,S., Burge,C.B. and Bartel,D.P.
TITLE Vertebrate microRNA genes
JOURNAL Science 299 (5612), 1540 (2003)
PUBMED 12624257
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AC021118.6.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-110 AC021118.6 58837-58946
FEATURES Location/Qualifiers
source 1..110
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="4"
/map="4p15.31"
gene 1..110
/gene="MIR218-1"
/gene_synonym="mir-218-1; MIRN218-1"
/note="microRNA 218-1"
/db_xref="GeneID:407000"
/db_xref="HGNC:31595"
/db_xref="miRBase:MI0000294"
precursor_RNA 1..110
/gene="MIR218-1"
/gene_synonym="mir-218-1; MIRN218-1"
/product="microRNA 218-1"
/db_xref="GeneID:407000"
/db_xref="HGNC:31595"
/db_xref="miRBase:MI0000294"
exon 1..110
/gene="MIR218-1"
/gene_synonym="mir-218-1; MIRN218-1"
/inference="alignment:Splign:1.39.8"
ncRNA 25..45
/gene="MIR218-1"
/gene_synonym="mir-218-1; MIRN218-1"
/ncRNA_class="miRNA"
/product="hsa-miR-218-5p"
/db_xref="miRBase:MIMAT0000275"
/db_xref="GeneID:407000"
/db_xref="HGNC:31595"
/db_xref="miRBase:MI0000294"
variation 52
/gene="MIR218-1"
/gene_synonym="mir-218-1; MIRN218-1"
/replace="a"
/replace="g"
/db_xref="dbSNP:367747283"
variation 64
/gene="MIR218-1"
/gene_synonym="mir-218-1; MIRN218-1"
/replace="a"
/replace="g"
/db_xref="dbSNP:371622197"
ncRNA 68..89
/gene="MIR218-1"
/gene_synonym="mir-218-1; MIRN218-1"
/ncRNA_class="miRNA"
/product="hsa-miR-218-1-3p"
/db_xref="miRBase:MIMAT0004565"
/db_xref="GeneID:407000"
/db_xref="HGNC:31595"
/db_xref="miRBase:MI0000294"
variation 75
/gene="MIR218-1"
/gene_synonym="mir-218-1; MIRN218-1"
/replace="c"
/replace="t"
/db_xref="dbSNP:376226736"
variation 100
/gene="MIR218-1"
/gene_synonym="mir-218-1; MIRN218-1"
/replace="a"
/replace="g"
/db_xref="dbSNP:372540867"
ORIGIN
gtgataatgtagcgagattttctgttgtgcttgatctaaccatgtggttgcgaggtatgagtaaaacatggttccgtcaagcaccatggaacgtcacgcagctttctaca
//
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.