Home |
Help |
Advanced search
2025-05-12 02:00:16, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_133499 3172 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens synapsin I (SYN1), transcript variant Ib, mRNA.
ACCESSION NM_133499
VERSION NM_133499.2 GI:91984782
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3172)
AUTHORS Paonessa,F., Latifi,S., Scarongella,H., Cesca,F. and Benfenati,F.
TITLE Specificity protein 1 (Sp1)-dependent activation of the synapsin I
gene (SYN1) is modulated by RE1-silencing transcription factor
(REST) and 5'-cytosine-phosphoguanine (CpG) methylation
JOURNAL J. Biol. Chem. 288 (5), 3227-3239 (2013)
PUBMED 23250796
REMARK GeneRIF: A conserved region of human and mouse SYN1 promoters
contains cis-sites for the transcriptional activator Sp1 in close
proximity to REST binding motifs.
REFERENCE 2 (bases 1 to 3172)
AUTHORS Yu,G.I., Kim,S.K., Park,H.J., Kim,J.W., Chung,J.H. and Shin,D.H.
TITLE The C allele of synonymous SNP (rs1142636, Asn170Asn) in SYN1 is a
risk factor for the susceptibility of Korean female schizophrenia
JOURNAL Synapse 66 (11), 979-983 (2012)
PUBMED 22807112
REMARK GeneRIF: The allelic frequencies of SYN1 are associated with Korean
female schizophrenia.
REFERENCE 3 (bases 1 to 3172)
AUTHORS Fassio,A., Patry,L., Congia,S., Onofri,F., Piton,A., Gauthier,J.,
Pozzi,D., Messa,M., Defranchi,E., Fadda,M., Corradi,A.,
Baldelli,P., Lapointe,L., St-Onge,J., Meloche,C., Mottron,L.,
Valtorta,F., Khoa Nguyen,D., Rouleau,G.A., Benfenati,F. and
Cossette,P.
TITLE SYN1 loss-of-function mutations in autism and partial epilepsy
cause impaired synaptic function
JOURNAL Hum. Mol. Genet. 20 (12), 2297-2307 (2011)
PUBMED 21441247
REMARK GeneRIF: SYN1 loss-of-function mutations in autism and partial
epilepsy cause impaired synaptic function.
REFERENCE 4 (bases 1 to 3172)
AUTHORS Fei,E., Ma,X., Zhu,C., Xue,T., Yan,J., Xu,Y., Zhou,J. and Wang,G.
TITLE Nucleocytoplasmic shuttling of dysbindin-1, a schizophrenia-related
protein, regulates synapsin I expression
JOURNAL J. Biol. Chem. 285 (49), 38630-38640 (2010)
PUBMED 20921223
REMARK GeneRIF: the nucleocytoplasmic shuttling of dysbindin-1 regulates
synapsin I expression and thus may be involved in the pathogenesis
of schizophrenia.
REFERENCE 5 (bases 1 to 3172)
AUTHORS Smith,A.J., Schacker,T.W., Reilly,C.S. and Haase,A.T.
TITLE A role for syndecan-1 and claudin-2 in microbial translocation
during HIV-1 infection
JOURNAL J. Acquir. Immune Defic. Syndr. 55 (3), 306-315 (2010)
PUBMED 20700059
REMARK GeneRIF: The authors propose claudin-2 and SYN1 work in concert to
enhance microbial translocation across the intestinal epithelial
barrier to contribute to chronic immune activation and CD4 T-cell
depletion in HIV-1-infected patients.
REFERENCE 6 (bases 1 to 3172)
AUTHORS Kirchgessner,C.U., Trofatter,J.A., Mahtani,M.M., Willard,H.F. and
DeGennaro,L.J.
TITLE A highly polymorphic dinucleotide repeat on the proximal short arm
of the human X chromosome: linkage mapping of the synapsin
I/A-raf-1 genes
JOURNAL Am. J. Hum. Genet. 49 (1), 184-191 (1991)
PUBMED 1905878
REFERENCE 7 (bases 1 to 3172)
AUTHORS Bennett,A.F., Hayes,N.V. and Baines,A.J.
TITLE Site specificity in the interactions of synapsin 1 with tubulin
JOURNAL Biochem. J. 276 (PT 3), 793-799 (1991)
PUBMED 1905928
REFERENCE 8 (bases 1 to 3172)
AUTHORS Sauerwald,A., Hoesche,C., Oschwald,R. and Kilimann,M.W.
TITLE The 5'-flanking region of the synapsin I gene. A G+C-rich, TATA-
and CAAT-less, phylogenetically conserved sequence with cell
type-specific promoter function
JOURNAL J. Biol. Chem. 265 (25), 14932-14937 (1990)
PUBMED 2118519
REFERENCE 9 (bases 1 to 3172)
AUTHORS Sudhof,T.C.
TITLE The structure of the human synapsin I gene and protein
JOURNAL J. Biol. Chem. 265 (14), 7849-7852 (1990)
PUBMED 2110562
REFERENCE 10 (bases 1 to 3172)
AUTHORS Sudhof,T.C., Czernik,A.J., Kao,H.T., Takei,K., Johnston,P.A.,
Horiuchi,A., Kanazir,S.D., Wagner,M.A., Perin,M.S., De Camilli,P.
et al.
TITLE Synapsins: mosaics of shared and individual domains in a family of
synaptic vesicle phosphoproteins
JOURNAL Science 245 (4925), 1474-1480 (1989)
PUBMED 2506642
REMARK Review article
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AI929645.1, BC048799.1 and
BC036711.2.
On Apr 13, 2006 this sequence version replaced gi:19924096.
Summary: This gene is a member of the synapsin gene family.
Synapsins encode neuronal phosphoproteins which associate with the
cytoplasmic surface of synaptic vesicles. Family members are
characterized by common protein domains, and they are implicated in
synaptogenesis and the modulation of neurotransmitter release,
suggesting a potential role in several neuropsychiatric diseases.
This member of the synapsin family plays a role in regulation of
axonogenesis and synaptogenesis. The protein encoded serves as a
substrate for several different protein kinases and phosphorylation
may function in the regulation of this protein in the nerve
terminal. Mutations in this gene may be associated with X-linked
disorders with primary neuronal degeneration such as Rett syndrome.
Alternatively spliced transcript variants encoding different
isoforms have been identified. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (Ib) utilizes an alternative
splice acceptor site in terminal exon compared to variant Ia,
resulting in the lack of an internal segment and a frameshift. This
variant encodes isoform Ib, which contains a shorter carboxyl
terminus and a distinct domain F, as compared to isoform Ia.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC048799.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025088 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: full length.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-16 AI929645.1 50-65
17-1203 BC048799.1 1-1187
1204-3169 BC036711.2 649-2614
3170-3172 BC048799.1 3152-3154
FEATURES Location/Qualifiers
source 1..3172
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="X"
/map="Xp11.23"
gene 1..3172
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/note="synapsin I"
/db_xref="GeneID:6853"
/db_xref="HGNC:11494"
/db_xref="HPRD:02433"
/db_xref="MIM:313440"
exon 1..506
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/inference="alignment:Splign:1.39.8"
misc_feature 103..105
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/note="upstream in-frame stop codon"
CDS 130..2139
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/note="isoform Ib is encoded by transcript variant Ib;
brain protein 4.1; synapsin-1"
/codon_start=1
/product="synapsin-1 isoform Ib"
/protein_id="NP_598006.1"
/db_xref="GI:19924097"
/db_xref="CCDS:CCDS35233.1"
/db_xref="GeneID:6853"
/db_xref="HGNC:11494"
/db_xref="HPRD:02433"
/db_xref="MIM:313440"
/translation="
MNYLRRRLSDSNFMANLPNGYMTDLQRPQPPPPPPGAHSPGATPGPGTATAERSSGVAPAASPAAPSPGSSGGGGFFSSLSNAVKQTTAAAAATFSEQVGGGSGGAGRGGAASRVLLVIDEPHTDWAKYFKGKKIHGEIDIKVEQAEFSDLNLVAHANGGFSVDMEVLRNGVKVVRSLKPDFVLIRQHAFSMARNGDYRSLVIGLQYAGIPSVNSLHSVYNFCDKPWVFAQMVRLHKKLGTEEFPLIDQTFYPNHKEMLSSTTYPVVVKMGHAHSGMGKVKVDNQHDFQDIASVVALTKTYATAEPFIDAKYDVRVQKIGQNYKAYMRTSVSGNWKTNTGSAMLEQIAMSDRYKLWVDTCSEIFGGLDICAVEALHGKDGRDHIIEVVGSSMPLIGDHQDEDKQLIVELVVNKMAQALPRQRQRDASPGRGSHGQTPSPGALPLGRQTSQQPAGPPAQQRPPPQGGPPQPGPGPQRQGPPLQQRPPPQGQQHLSGLGPPAGSPLPQRLPSPTSAPQQPASQAAPPTQGQGRQSRPVAGGPGAPPAARPPASPSPQRQAGPPQATRQTSVSGPAPPKASGAPPGGQQRQGPPQKPPGPAGPTRQASQAGPVPRTGPPTTQQPRPSGPGPAGRPKPQLAQKPSQDVPPPATAAAGGPPHPQLKASPAQAQP
"
misc_feature 130..213
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P17600.3);
Region: A"
misc_feature 130..210
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/note="Synapsin N-terminal; Region: Synapsin_N; pfam10581"
/db_xref="CDD:119101"
misc_feature 154..156
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by CaMK1 and PKA, alternate;
propagated from UniProtKB/Swiss-Prot (P17600.3);
phosphorylation site"
misc_feature 154..156
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:03382"
misc_feature 154..156
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05412"
misc_feature 154..156
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:05428"
misc_feature 214..465
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P17600.3);
Region: B, linker"
misc_feature 313..315
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00449"
misc_feature 328..330
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00449"
misc_feature 388..390
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="glycosylation site"
misc_feature 415..417
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="glycosylation site"
misc_feature 436..438
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="glycosylation site"
misc_feature 466..1389
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P17600.3);
Region: C, actin-binding and synaptic-vesicle binding"
misc_feature 472..765
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/note="Synapsin, N-terminal domain; Region: Synapsin;
pfam02078"
/db_xref="CDD:111020"
misc_feature 499..1392
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/note="Glutathione synthase/Ribosomal protein S6
modification enzyme (glutaminyl transferase) [Coenzyme
metabolism / Translation, ribosomal structure and
biogenesis]; Region: RimK; COG0189"
/db_xref="CDD:30538"
misc_feature 769..1377
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/note="Synapsin, ATP binding domain; Region: Synapsin_C;
pfam02750"
/db_xref="CDD:111626"
misc_feature 910..912
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="glycosylation site"
misc_feature 1390..2094
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P17600.3);
Region: D, Pro-rich linker"
misc_feature 1423..1425
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="glycosylation site"
misc_feature 1657..1659
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1705..1707
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="glycosylation site"
misc_feature 1780..1782
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by PDPK1; propagated from
UniProtKB/Swiss-Prot (P17600.3); phosphorylation site"
misc_feature 1780..1782
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00449"
misc_feature 1786..1788
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P17600.3); phosphorylation site"
misc_feature 1786..1788
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00449"
misc_feature 1819..1821
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="glycosylation site"
misc_feature 1831..1833
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by CaMK2; propagated from
UniProtKB/Swiss-Prot (P17600.3); phosphorylation site"
misc_feature 1831..1833
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:03672"
misc_feature 1861..1863
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="glycosylation site"
misc_feature 1942..1944
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by CaMK2; propagated from
UniProtKB/Swiss-Prot (P17600.3); phosphorylation site"
misc_feature 1942..1944
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:03672"
misc_feature 1942..1944
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:03995"
misc_feature 1942..1944
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:02142"
exon 507..564
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/inference="alignment:Splign:1.39.8"
variation 561
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/replace="a"
/replace="g"
/db_xref="dbSNP:1142635"
exon 565..656
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/inference="alignment:Splign:1.39.8"
variation 639
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:1142636"
exon 657..813
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/inference="alignment:Splign:1.39.8"
exon 814..903
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/inference="alignment:Splign:1.39.8"
exon 904..966
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/inference="alignment:Splign:1.39.8"
exon 967..1109
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/inference="alignment:Splign:1.39.8"
exon 1110..1184
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/inference="alignment:Splign:1.39.8"
exon 1185..1287
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/inference="alignment:Splign:1.39.8"
exon 1288..1434
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/inference="alignment:Splign:1.39.8"
exon 1435..1522
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/inference="alignment:Splign:1.39.8"
exon 1523..2111
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/inference="alignment:Splign:1.39.8"
exon 2112..3172
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/inference="alignment:Splign:1.39.8"
STS 2222..2350
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/standard_name="STS-M58378"
/db_xref="UniSTS:11300"
STS 2885..3093
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/standard_name="RH79877"
/db_xref="UniSTS:89581"
STS 2896..3057
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
/standard_name="RH93525"
/db_xref="UniSTS:85565"
polyA_signal 3150..3155
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
polyA_site 3172
/gene="SYN1"
/gene_synonym="SYN1a; SYN1b; SYNI"
ORIGIN
agtctgcggtgggcagcggaggagtcgtgtcgtgcctgagagcgcagctgtgctcctgggcaccgcgcagtccgcccccgcggctcctggccagaccacccctaggaccccctgccccaagtcgcagccatgaactacctgcggcgccgcctgtcggacagcaactttatggccaatctgccaaatgggtacatgacagacctgcagcgtccgcagccgcccccaccgccgcccggtgcccacagccccggagccacgcccggtcccgggaccgccactgccgagaggtcctccggggtcgccccagcggcctctccggccgcccctagccccgggtcctcggggggcggtggcttcttctcgtcgctgtccaacgcggtcaagcagaccacggcggcggcagctgccaccttcagcgagcaggtgggcggcggctctgggggcgcaggccgcgggggagccgcctccagggtgctgctggtcatcgacgagccgcacaccgactgggcaaaatacttcaaagggaaaaagatccatggagaaattgacattaaagtagaacaggccgaattctctgatctcaaccttgtggcccatgccaatggtggattctctgtggatatggaagttcttcggaatggggtgaaggtcgtgcggtctctgaagccggattttgtgctgatccgccagcacgccttcagcatggcacgcaacggagactaccgcagtttggtcattgggctgcagtatgctggaatccccagtgttaactccttgcattctgtctacaacttctgtgacaagccctgggtgtttgcccagatggttcgactgcataagaaactggggacagaagaattccctctaattgatcagaccttctaccccaatcacaaagaaatgctcagcagtacaacgtaccccgtggttgtgaagatggggcacgcacactctgggatgggcaaggtcaaggttgacaaccagcatgacttccaggacatcgcaagtgtcgtggcactgaccaagacgtatgccactgccgagcccttcatcgatgccaaatatgacgtgcgtgtccagaagattgggcagaactacaaggcctacatgaggacgtcagtgtcagggaactggaagaccaatactggctctgcgatgctggagcaaattgccatgtctgacagatacaagctgtgggtggacacgtgctcagagatttttgggggactggacatctgcgcagtggaagcgctacatggcaaggacggaagggatcacatcattgaggtggtgggttcctccatgccgctcattggtgaccaccaggatgaagacaaacagctcatcgtagagctcgtggtcaacaagatggctcaggccctgccccggcagcgacagcgggatgcctcccctggcaggggctcccatggccagactccgtccccaggggccctgcccttgggccgccagacctcccagcagcccgcagggcccccggctcagcagcgacccccaccacagggcggccctccacagccgggtccaggcccccagcgccagggacccccattgcagcagcgcccgcccccgcagggccagcagcacctttcaggccttggacccccagctggcagccccctgccccagcgccttccaagtcccacctcagcgccccagcagcccgcgtcccaggccgcgccgccgacccagggtcaaggccgccaatcccggccagtggcgggaggccccggggcgcctccagcagcccgcccgcccgcctctccgtctccccagcgccaggcgggccccccacaggctacccgtcagacatccgtctctggcccggctccgccaaaggcctctggggccccaccgggcgggcagcagcgccagggcccgccccagaaacccccaggcccagccggccccacacgccaggccagccaggcgggtcccgtgccccgcactgggccacccaccacgcagcagcctcggcccagcggcccgggccccgctggacgtcccaaaccacagctggcccagaaacccagccaggacgtgccgccacccgccaccgccgctgcagggggacctccgcacccccagctcaaagccagccccgcccaggcccagccttagccaggacgaggtgaaagctgagaccatccgcagcctgaggaagtctttcgccagcctcttctccgactgataccccactctgagaaccccaaaatccctgggcaacccttctctgggccctgaatccatttctcacttttggagtctccaaatcccttgagaacccatctcccggttctccaagattccacctctcattcctcaagatccccgagtaccttgagaaacctgactcctcctggccctaaatccggttctcacatgtggaatccccaagtccttttagaaccccactcgtggtcacttcaggatctacttctgttttagaacctccacattcctgaagacctccgcccctggtttccccagagggcgttttccttcctggaagtgcccaaataccaggcaacccattgcagaatcccttcctggagccctgaagttcctggaaaaccctatttttggtcccaaatctctccagcacacctatttcccatcataattttccaaatcctcaagaaacccctactgttgagccccttcccatggatcttccatccctctgaagatccacatcttcaaatgccacccaacacctagccccacaaggatttcccttcaccagctcccctcaacctcattcaataccttgggagcccctcccacttccaggacccctcggttcccccagggaccccctccccagtttcctgcctctgacagctgtctttaaatatgcaaactccacccatcttcccagaatcctttgcacacggaaggccagtggtctccgcttccccacctttgctgtggtgtctgtgtctgtgactgacgtggcctccttttgtgccgtgcttggcatatgtggtcctcgttcatcgtgccgcctgtggtgatgcgtgcagtgacgctgtttatgtggtccgcacctccccctgaccttcactccttgcctggactcaccccacccctcagcggctctgaaccccaagagaagagtcgggaaacaaaataaacaagcaaaggcccagca
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:6853 -> Molecular function: GO:0003779 [actin binding] evidence: IEA
GeneID:6853 -> Molecular function: GO:0003824 [catalytic activity] evidence: IEA
GeneID:6853 -> Molecular function: GO:0005215 [transporter activity] evidence: TAS
GeneID:6853 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
GeneID:6853 -> Biological process: GO:0007268 [synaptic transmission] evidence: TAS
GeneID:6853 -> Biological process: GO:0007269 [neurotransmitter secretion] evidence: IEA
GeneID:6853 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: IEA
GeneID:6853 -> Cellular component: GO:0005829 [cytosol] evidence: IEA
GeneID:6853 -> Cellular component: GO:0008021 [synaptic vesicle] evidence: IEA
GeneID:6853 -> Cellular component: GO:0030054 [cell junction] evidence: IEA
GeneID:6853 -> Cellular component: GO:0030425 [dendrite] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.