GGRNA Home | Help | Advanced search

2025-05-12 02:00:16, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_133499               3172 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens synapsin I (SYN1), transcript variant Ib, mRNA.
ACCESSION   NM_133499
VERSION     NM_133499.2  GI:91984782
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3172)
  AUTHORS   Paonessa,F., Latifi,S., Scarongella,H., Cesca,F. and Benfenati,F.
  TITLE     Specificity protein 1 (Sp1)-dependent activation of the synapsin I
            gene (SYN1) is modulated by RE1-silencing transcription factor
            (REST) and 5'-cytosine-phosphoguanine (CpG) methylation
  JOURNAL   J. Biol. Chem. 288 (5), 3227-3239 (2013)
   PUBMED   23250796
  REMARK    GeneRIF: A conserved region of human and mouse SYN1 promoters
            contains cis-sites for the transcriptional activator Sp1 in close
            proximity to REST binding motifs.
REFERENCE   2  (bases 1 to 3172)
  AUTHORS   Yu,G.I., Kim,S.K., Park,H.J., Kim,J.W., Chung,J.H. and Shin,D.H.
  TITLE     The C allele of synonymous SNP (rs1142636, Asn170Asn) in SYN1 is a
            risk factor for the susceptibility of Korean female schizophrenia
  JOURNAL   Synapse 66 (11), 979-983 (2012)
   PUBMED   22807112
  REMARK    GeneRIF: The allelic frequencies of SYN1 are associated with Korean
            female schizophrenia.
REFERENCE   3  (bases 1 to 3172)
  AUTHORS   Fassio,A., Patry,L., Congia,S., Onofri,F., Piton,A., Gauthier,J.,
            Pozzi,D., Messa,M., Defranchi,E., Fadda,M., Corradi,A.,
            Baldelli,P., Lapointe,L., St-Onge,J., Meloche,C., Mottron,L.,
            Valtorta,F., Khoa Nguyen,D., Rouleau,G.A., Benfenati,F. and
            Cossette,P.
  TITLE     SYN1 loss-of-function mutations in autism and partial epilepsy
            cause impaired synaptic function
  JOURNAL   Hum. Mol. Genet. 20 (12), 2297-2307 (2011)
   PUBMED   21441247
  REMARK    GeneRIF: SYN1 loss-of-function mutations in autism and partial
            epilepsy cause impaired synaptic function.
REFERENCE   4  (bases 1 to 3172)
  AUTHORS   Fei,E., Ma,X., Zhu,C., Xue,T., Yan,J., Xu,Y., Zhou,J. and Wang,G.
  TITLE     Nucleocytoplasmic shuttling of dysbindin-1, a schizophrenia-related
            protein, regulates synapsin I expression
  JOURNAL   J. Biol. Chem. 285 (49), 38630-38640 (2010)
   PUBMED   20921223
  REMARK    GeneRIF: the nucleocytoplasmic shuttling of dysbindin-1 regulates
            synapsin I expression and thus may be involved in the pathogenesis
            of schizophrenia.
REFERENCE   5  (bases 1 to 3172)
  AUTHORS   Smith,A.J., Schacker,T.W., Reilly,C.S. and Haase,A.T.
  TITLE     A role for syndecan-1 and claudin-2 in microbial translocation
            during HIV-1 infection
  JOURNAL   J. Acquir. Immune Defic. Syndr. 55 (3), 306-315 (2010)
   PUBMED   20700059
  REMARK    GeneRIF: The authors propose claudin-2 and SYN1 work in concert to
            enhance microbial translocation across the intestinal epithelial
            barrier to contribute to chronic immune activation and CD4 T-cell
            depletion in HIV-1-infected patients.
REFERENCE   6  (bases 1 to 3172)
  AUTHORS   Kirchgessner,C.U., Trofatter,J.A., Mahtani,M.M., Willard,H.F. and
            DeGennaro,L.J.
  TITLE     A highly polymorphic dinucleotide repeat on the proximal short arm
            of the human X chromosome: linkage mapping of the synapsin
            I/A-raf-1 genes
  JOURNAL   Am. J. Hum. Genet. 49 (1), 184-191 (1991)
   PUBMED   1905878
REFERENCE   7  (bases 1 to 3172)
  AUTHORS   Bennett,A.F., Hayes,N.V. and Baines,A.J.
  TITLE     Site specificity in the interactions of synapsin 1 with tubulin
  JOURNAL   Biochem. J. 276 (PT 3), 793-799 (1991)
   PUBMED   1905928
REFERENCE   8  (bases 1 to 3172)
  AUTHORS   Sauerwald,A., Hoesche,C., Oschwald,R. and Kilimann,M.W.
  TITLE     The 5'-flanking region of the synapsin I gene. A G+C-rich, TATA-
            and CAAT-less, phylogenetically conserved sequence with cell
            type-specific promoter function
  JOURNAL   J. Biol. Chem. 265 (25), 14932-14937 (1990)
   PUBMED   2118519
REFERENCE   9  (bases 1 to 3172)
  AUTHORS   Sudhof,T.C.
  TITLE     The structure of the human synapsin I gene and protein
  JOURNAL   J. Biol. Chem. 265 (14), 7849-7852 (1990)
   PUBMED   2110562
REFERENCE   10 (bases 1 to 3172)
  AUTHORS   Sudhof,T.C., Czernik,A.J., Kao,H.T., Takei,K., Johnston,P.A.,
            Horiuchi,A., Kanazir,S.D., Wagner,M.A., Perin,M.S., De Camilli,P.
            et al.
  TITLE     Synapsins: mosaics of shared and individual domains in a family of
            synaptic vesicle phosphoproteins
  JOURNAL   Science 245 (4925), 1474-1480 (1989)
   PUBMED   2506642
  REMARK    Review article
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AI929645.1, BC048799.1 and
            BC036711.2.
            On Apr 13, 2006 this sequence version replaced gi:19924096.
            
            Summary: This gene is a member of the synapsin gene family.
            Synapsins encode neuronal phosphoproteins which associate with the
            cytoplasmic surface of synaptic vesicles. Family members are
            characterized by common protein domains, and they are implicated in
            synaptogenesis and the modulation of neurotransmitter release,
            suggesting a potential role in several neuropsychiatric diseases.
            This member of the synapsin family plays a role in regulation of
            axonogenesis and synaptogenesis. The protein encoded serves as a
            substrate for several different protein kinases and phosphorylation
            may function in the regulation of this protein in the nerve
            terminal. Mutations in this gene may be associated with X-linked
            disorders with primary neuronal degeneration such as Rett syndrome.
            Alternatively spliced transcript variants encoding different
            isoforms have been identified. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (Ib) utilizes an alternative
            splice acceptor site in terminal exon compared to variant Ia,
            resulting in the lack of an internal segment and a frameshift. This
            variant encodes isoform Ib, which contains a shorter carboxyl
            terminus and a distinct domain F, as compared to isoform Ia.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC048799.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025088 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-16                AI929645.1         50-65
            17-1203             BC048799.1         1-1187
            1204-3169           BC036711.2         649-2614
            3170-3172           BC048799.1         3152-3154
FEATURES             Location/Qualifiers
     source          1..3172
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="X"
                     /map="Xp11.23"
     gene            1..3172
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /note="synapsin I"
                     /db_xref="GeneID:6853"
                     /db_xref="HGNC:11494"
                     /db_xref="HPRD:02433"
                     /db_xref="MIM:313440"
     exon            1..506
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    103..105
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /note="upstream in-frame stop codon"
     CDS             130..2139
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /note="isoform Ib is encoded by transcript variant Ib;
                     brain protein 4.1; synapsin-1"
                     /codon_start=1
                     /product="synapsin-1 isoform Ib"
                     /protein_id="NP_598006.1"
                     /db_xref="GI:19924097"
                     /db_xref="CCDS:CCDS35233.1"
                     /db_xref="GeneID:6853"
                     /db_xref="HGNC:11494"
                     /db_xref="HPRD:02433"
                     /db_xref="MIM:313440"
                     /translation="
MNYLRRRLSDSNFMANLPNGYMTDLQRPQPPPPPPGAHSPGATPGPGTATAERSSGVAPAASPAAPSPGSSGGGGFFSSLSNAVKQTTAAAAATFSEQVGGGSGGAGRGGAASRVLLVIDEPHTDWAKYFKGKKIHGEIDIKVEQAEFSDLNLVAHANGGFSVDMEVLRNGVKVVRSLKPDFVLIRQHAFSMARNGDYRSLVIGLQYAGIPSVNSLHSVYNFCDKPWVFAQMVRLHKKLGTEEFPLIDQTFYPNHKEMLSSTTYPVVVKMGHAHSGMGKVKVDNQHDFQDIASVVALTKTYATAEPFIDAKYDVRVQKIGQNYKAYMRTSVSGNWKTNTGSAMLEQIAMSDRYKLWVDTCSEIFGGLDICAVEALHGKDGRDHIIEVVGSSMPLIGDHQDEDKQLIVELVVNKMAQALPRQRQRDASPGRGSHGQTPSPGALPLGRQTSQQPAGPPAQQRPPPQGGPPQPGPGPQRQGPPLQQRPPPQGQQHLSGLGPPAGSPLPQRLPSPTSAPQQPASQAAPPTQGQGRQSRPVAGGPGAPPAARPPASPSPQRQAGPPQATRQTSVSGPAPPKASGAPPGGQQRQGPPQKPPGPAGPTRQASQAGPVPRTGPPTTQQPRPSGPGPAGRPKPQLAQKPSQDVPPPATAAAGGPPHPQLKASPAQAQP
"
     misc_feature    130..213
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P17600.3);
                     Region: A"
     misc_feature    130..210
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /note="Synapsin N-terminal; Region: Synapsin_N; pfam10581"
                     /db_xref="CDD:119101"
     misc_feature    154..156
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by CaMK1 and PKA, alternate;
                     propagated from UniProtKB/Swiss-Prot (P17600.3);
                     phosphorylation site"
     misc_feature    154..156
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:03382"
     misc_feature    154..156
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:05412"
     misc_feature    154..156
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:05428"
     misc_feature    214..465
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P17600.3);
                     Region: B, linker"
     misc_feature    313..315
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00449"
     misc_feature    328..330
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00449"
     misc_feature    388..390
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="glycosylation site"
     misc_feature    415..417
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="glycosylation site"
     misc_feature    436..438
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="glycosylation site"
     misc_feature    466..1389
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P17600.3);
                     Region: C, actin-binding and synaptic-vesicle binding"
     misc_feature    472..765
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /note="Synapsin, N-terminal domain; Region: Synapsin;
                     pfam02078"
                     /db_xref="CDD:111020"
     misc_feature    499..1392
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /note="Glutathione synthase/Ribosomal protein S6
                     modification enzyme (glutaminyl transferase) [Coenzyme
                     metabolism / Translation, ribosomal structure and
                     biogenesis]; Region: RimK; COG0189"
                     /db_xref="CDD:30538"
     misc_feature    769..1377
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /note="Synapsin, ATP binding domain; Region: Synapsin_C;
                     pfam02750"
                     /db_xref="CDD:111626"
     misc_feature    910..912
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="glycosylation site"
     misc_feature    1390..2094
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P17600.3);
                     Region: D, Pro-rich linker"
     misc_feature    1423..1425
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="glycosylation site"
     misc_feature    1657..1659
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1705..1707
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="glycosylation site"
     misc_feature    1780..1782
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by PDPK1; propagated from
                     UniProtKB/Swiss-Prot (P17600.3); phosphorylation site"
     misc_feature    1780..1782
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00449"
     misc_feature    1786..1788
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (P17600.3); phosphorylation site"
     misc_feature    1786..1788
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:00449"
     misc_feature    1819..1821
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="glycosylation site"
     misc_feature    1831..1833
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by CaMK2; propagated from
                     UniProtKB/Swiss-Prot (P17600.3); phosphorylation site"
     misc_feature    1831..1833
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:03672"
     misc_feature    1861..1863
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="glycosylation site"
     misc_feature    1942..1944
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine, by CaMK2; propagated from
                     UniProtKB/Swiss-Prot (P17600.3); phosphorylation site"
     misc_feature    1942..1944
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:03672"
     misc_feature    1942..1944
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:03995"
     misc_feature    1942..1944
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /db_xref="HPRD:02142"
     exon            507..564
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /inference="alignment:Splign:1.39.8"
     variation       561
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1142635"
     exon            565..656
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /inference="alignment:Splign:1.39.8"
     variation       639
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1142636"
     exon            657..813
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /inference="alignment:Splign:1.39.8"
     exon            814..903
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /inference="alignment:Splign:1.39.8"
     exon            904..966
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /inference="alignment:Splign:1.39.8"
     exon            967..1109
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /inference="alignment:Splign:1.39.8"
     exon            1110..1184
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /inference="alignment:Splign:1.39.8"
     exon            1185..1287
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /inference="alignment:Splign:1.39.8"
     exon            1288..1434
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /inference="alignment:Splign:1.39.8"
     exon            1435..1522
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /inference="alignment:Splign:1.39.8"
     exon            1523..2111
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /inference="alignment:Splign:1.39.8"
     exon            2112..3172
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /inference="alignment:Splign:1.39.8"
     STS             2222..2350
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /standard_name="STS-M58378"
                     /db_xref="UniSTS:11300"
     STS             2885..3093
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /standard_name="RH79877"
                     /db_xref="UniSTS:89581"
     STS             2896..3057
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
                     /standard_name="RH93525"
                     /db_xref="UniSTS:85565"
     polyA_signal    3150..3155
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
     polyA_site      3172
                     /gene="SYN1"
                     /gene_synonym="SYN1a; SYN1b; SYNI"
ORIGIN      
agtctgcggtgggcagcggaggagtcgtgtcgtgcctgagagcgcagctgtgctcctgggcaccgcgcagtccgcccccgcggctcctggccagaccacccctaggaccccctgccccaagtcgcagccatgaactacctgcggcgccgcctgtcggacagcaactttatggccaatctgccaaatgggtacatgacagacctgcagcgtccgcagccgcccccaccgccgcccggtgcccacagccccggagccacgcccggtcccgggaccgccactgccgagaggtcctccggggtcgccccagcggcctctccggccgcccctagccccgggtcctcggggggcggtggcttcttctcgtcgctgtccaacgcggtcaagcagaccacggcggcggcagctgccaccttcagcgagcaggtgggcggcggctctgggggcgcaggccgcgggggagccgcctccagggtgctgctggtcatcgacgagccgcacaccgactgggcaaaatacttcaaagggaaaaagatccatggagaaattgacattaaagtagaacaggccgaattctctgatctcaaccttgtggcccatgccaatggtggattctctgtggatatggaagttcttcggaatggggtgaaggtcgtgcggtctctgaagccggattttgtgctgatccgccagcacgccttcagcatggcacgcaacggagactaccgcagtttggtcattgggctgcagtatgctggaatccccagtgttaactccttgcattctgtctacaacttctgtgacaagccctgggtgtttgcccagatggttcgactgcataagaaactggggacagaagaattccctctaattgatcagaccttctaccccaatcacaaagaaatgctcagcagtacaacgtaccccgtggttgtgaagatggggcacgcacactctgggatgggcaaggtcaaggttgacaaccagcatgacttccaggacatcgcaagtgtcgtggcactgaccaagacgtatgccactgccgagcccttcatcgatgccaaatatgacgtgcgtgtccagaagattgggcagaactacaaggcctacatgaggacgtcagtgtcagggaactggaagaccaatactggctctgcgatgctggagcaaattgccatgtctgacagatacaagctgtgggtggacacgtgctcagagatttttgggggactggacatctgcgcagtggaagcgctacatggcaaggacggaagggatcacatcattgaggtggtgggttcctccatgccgctcattggtgaccaccaggatgaagacaaacagctcatcgtagagctcgtggtcaacaagatggctcaggccctgccccggcagcgacagcgggatgcctcccctggcaggggctcccatggccagactccgtccccaggggccctgcccttgggccgccagacctcccagcagcccgcagggcccccggctcagcagcgacccccaccacagggcggccctccacagccgggtccaggcccccagcgccagggacccccattgcagcagcgcccgcccccgcagggccagcagcacctttcaggccttggacccccagctggcagccccctgccccagcgccttccaagtcccacctcagcgccccagcagcccgcgtcccaggccgcgccgccgacccagggtcaaggccgccaatcccggccagtggcgggaggccccggggcgcctccagcagcccgcccgcccgcctctccgtctccccagcgccaggcgggccccccacaggctacccgtcagacatccgtctctggcccggctccgccaaaggcctctggggccccaccgggcgggcagcagcgccagggcccgccccagaaacccccaggcccagccggccccacacgccaggccagccaggcgggtcccgtgccccgcactgggccacccaccacgcagcagcctcggcccagcggcccgggccccgctggacgtcccaaaccacagctggcccagaaacccagccaggacgtgccgccacccgccaccgccgctgcagggggacctccgcacccccagctcaaagccagccccgcccaggcccagccttagccaggacgaggtgaaagctgagaccatccgcagcctgaggaagtctttcgccagcctcttctccgactgataccccactctgagaaccccaaaatccctgggcaacccttctctgggccctgaatccatttctcacttttggagtctccaaatcccttgagaacccatctcccggttctccaagattccacctctcattcctcaagatccccgagtaccttgagaaacctgactcctcctggccctaaatccggttctcacatgtggaatccccaagtccttttagaaccccactcgtggtcacttcaggatctacttctgttttagaacctccacattcctgaagacctccgcccctggtttccccagagggcgttttccttcctggaagtgcccaaataccaggcaacccattgcagaatcccttcctggagccctgaagttcctggaaaaccctatttttggtcccaaatctctccagcacacctatttcccatcataattttccaaatcctcaagaaacccctactgttgagccccttcccatggatcttccatccctctgaagatccacatcttcaaatgccacccaacacctagccccacaaggatttcccttcaccagctcccctcaacctcattcaataccttgggagcccctcccacttccaggacccctcggttcccccagggaccccctccccagtttcctgcctctgacagctgtctttaaatatgcaaactccacccatcttcccagaatcctttgcacacggaaggccagtggtctccgcttccccacctttgctgtggtgtctgtgtctgtgactgacgtggcctccttttgtgccgtgcttggcatatgtggtcctcgttcatcgtgccgcctgtggtgatgcgtgcagtgacgctgtttatgtggtccgcacctccccctgaccttcactccttgcctggactcaccccacccctcagcggctctgaaccccaagagaagagtcgggaaacaaaataaacaagcaaaggcccagca
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:6853 -> Molecular function: GO:0003779 [actin binding] evidence: IEA
            GeneID:6853 -> Molecular function: GO:0003824 [catalytic activity] evidence: IEA
            GeneID:6853 -> Molecular function: GO:0005215 [transporter activity] evidence: TAS
            GeneID:6853 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:6853 -> Biological process: GO:0007268 [synaptic transmission] evidence: TAS
            GeneID:6853 -> Biological process: GO:0007269 [neurotransmitter secretion] evidence: IEA
            GeneID:6853 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: IEA
            GeneID:6853 -> Cellular component: GO:0005829 [cytosol] evidence: IEA
            GeneID:6853 -> Cellular component: GO:0008021 [synaptic vesicle] evidence: IEA
            GeneID:6853 -> Cellular component: GO:0030054 [cell junction] evidence: IEA
            GeneID:6853 -> Cellular component: GO:0030425 [dendrite] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.