Home |
Help |
Advanced search
2025-05-12 01:24:08, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_004819 4188 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens symplekin (SYMPK), mRNA.
ACCESSION NM_004819
VERSION NM_004819.2 GI:124028528
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 4188)
AUTHORS Chang,H., Zhang,C. and Cao,Y.
TITLE Expression and distribution of symplekin regulates the assembly and
function of the epithelial tight junction
JOURNAL Histochem. Cell Biol. 137 (3), 319-327 (2012)
PUBMED 22218735
REMARK GeneRIF: Symplekin expression regulates the assembly of tight
junctions, thus helps to maintain the integrity of the epithelial
monolayer and cellular polarity.
REFERENCE 2 (bases 1 to 4188)
AUTHORS Cappell,K.M., Larson,B., Sciaky,N. and Whitehurst,A.W.
TITLE Symplekin specifies mitotic fidelity by supporting microtubule
dynamics
JOURNAL Mol. Cell. Biol. 30 (21), 5135-5144 (2010)
PUBMED 20823274
REMARK GeneRIF: Symplekin supports faithful mitosis by contributing to the
formation of a bipolar spindle apparatus. Depletion of symplekin
attenuates microtubule polymerization as well as expression of the
critical microtubule polymerization protein CKAP5 (TOGp).
REFERENCE 3 (bases 1 to 4188)
AUTHORS Xiang,K., Nagaike,T., Xiang,S., Kilic,T., Beh,M.M., Manley,J.L. and
Tong,L.
TITLE Crystal structure of the human symplekin-Ssu72-CTD phosphopeptide
complex
JOURNAL Nature 467 (7316), 729-733 (2010)
PUBMED 20861839
REMARK GeneRIF: crystal structure at 2.4 A resolution of the
amino-terminal domain (residues 30-340) of human symplekin in a
ternary complex with the Pol II carboxy-terminal domain (CTD) Ser 5
phosphatase Ssu72 and a CTD Ser 5 phosphopeptide
REFERENCE 4 (bases 1 to 4188)
AUTHORS Fransen,K., Visschedijk,M.C., van Sommeren,S., Fu,J.Y., Franke,L.,
Festen,E.A., Stokkers,P.C., van Bodegraven,A.A., Crusius,J.B.,
Hommes,D.W., Zanen,P., de Jong,D.J., Wijmenga,C., van Diemen,C.C.
and Weersma,R.K.
TITLE Analysis of SNPs with an effect on gene expression identifies
UBE2L3 and BCL3 as potential new risk genes for Crohn's disease
JOURNAL Hum. Mol. Genet. 19 (17), 3482-3488 (2010)
PUBMED 20601676
REMARK GeneRIF: Observational study and meta-analysis of gene-disease
association. (HuGE Navigator)
REFERENCE 5 (bases 1 to 4188)
AUTHORS Buchert,M., Papin,M., Bonnans,C., Darido,C., Raye,W.S.,
Garambois,V., Pelegrin,A., Bourgaux,J.F., Pannequin,J., Joubert,D.
and Hollande,F.
TITLE Symplekin promotes tumorigenicity by up-regulating claudin-2
expression
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 107 (6), 2628-2633 (2010)
PUBMED 20133805
REMARK GeneRIF: Data show that claudin-2 expression was reduced following
symplekin down-regulation, and siRNA-mediated claudin-2
down-regulation increased the transepithelial resistance and
decreased cyclin D1 expression and ZONAB nuclear localization.
REFERENCE 6 (bases 1 to 4188)
AUTHORS Takagaki,Y. and Manley,J.L.
TITLE Complex protein interactions within the human polyadenylation
machinery identify a novel component
JOURNAL Mol. Cell. Biol. 20 (5), 1515-1525 (2000)
PUBMED 10669729
REFERENCE 7 (bases 1 to 4188)
AUTHORS Faber,P.W., Barnes,G.T., Srinidhi,J., Chen,J., Gusella,J.F. and
MacDonald,M.E.
TITLE Huntingtin interacts with a family of WW domain proteins
JOURNAL Hum. Mol. Genet. 7 (9), 1463-1474 (1998)
PUBMED 9700202
REFERENCE 8 (bases 1 to 4188)
AUTHORS Alwazzan,M., Hamshere,M.G., Lennon,G.G. and Brook,J.D.
TITLE Six transcripts map within 200 kilobases of the myotonic dystrophy
expanded repeat
JOURNAL Mamm. Genome 9 (6), 485-487 (1998)
PUBMED 9585442
REFERENCE 9 (bases 1 to 4188)
AUTHORS Ueki,K., Ramaswamy,S., Billings,S.J., Mohrenweiser,H.W. and
Louis,D.N.
TITLE Chromosomal localization to 19q13.3, partial genomic structure and
5' cDNA sequence of the human symplekin gene
JOURNAL Somat. Cell Mol. Genet. 23 (3), 229-231 (1997)
PUBMED 9330635
REFERENCE 10 (bases 1 to 4188)
AUTHORS Keon,B.H., Schafer,S., Kuhn,C., Grund,C. and Franke,W.W.
TITLE Symplekin, a novel type of tight junction plaque protein
JOURNAL J. Cell Biol. 134 (4), 1003-1018 (1996)
PUBMED 8769423
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DB461873.1, DB044963.1,
BC006536.2, Y10931.1 and BU752018.1.
On Jan 23, 2007 this sequence version replaced gi:4759195.
Summary: This gene encodes a nuclear protein that functions in the
regulation of polyadenylation and promotes gene expression. The
protein forms a high-molecular weight complex with components of
the polyadenylation machinery. It is thought to serve as a scaffold
for recruiting regulatory factors to the polyadenylation complex.
It also participates in 3'-end maturation of histone mRNAs, which
do not undergo polyadenylation. The protein also localizes to the
cytoplasmic plaques of tight junctions in some cell types.
[provided by RefSeq, Jul 2008].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AK300252.1, Y10931.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-72 DB461873.1 1-72
73-586 DB044963.1 49-562
587-1381 BC006536.2 294-1088
1382-4166 Y10931.1 1200-3984
4167-4188 BU752018.1 21-42 c
FEATURES Location/Qualifiers
source 1..4188
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="19"
/map="19q13.3"
gene 1..4188
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/note="symplekin"
/db_xref="GeneID:8189"
/db_xref="HGNC:22935"
/db_xref="MIM:602388"
exon 1..233
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
variation 169..171
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/replace=""
/replace="cgg"
/db_xref="dbSNP:3840932"
misc_feature 198..200
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/note="upstream in-frame stop codon"
exon 234..350
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
CDS 246..4070
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/codon_start=1
/product="symplekin"
/protein_id="NP_004810.2"
/db_xref="GI:124028529"
/db_xref="CCDS:CCDS12676.2"
/db_xref="GeneID:8189"
/db_xref="HGNC:22935"
/db_xref="MIM:602388"
/translation="
MASGSGDSVTRRSVASQFFTQEEGPGIDGMTTSERVVDLLNQAALITNDSKITVLKQVQELIINKDPTLLDNFLDEIIAFQADKSIEVRKFVIGFIEEACKRDIELLLKLIANLNMLLRDENVNVVKKAILTMTQLYKVALQWMVKSRVISELQEACWDMVSAMAGDIILLLDSDNDGIRTHAIKFVEGLIVTLSPRMADSEIPRRQEHDISLDRIPRDHPYIQYNVLWEEGKAALEQLLKFMVHPAISSINLTTALGSLANIARQRPMFMSEVIQAYETLHANLPPTLAKSQVSSVRKNLKLHLLSVLKHPASLEFQAQITTLLVDLGTPQAEIARNMPSSKDTRKRPRDDSDSTLKKMKLEPNLGEDDEDKDLEPGPSGTSKASAQISGQSDTDITAEFLQPLLTPDNVANLVLISMVYLPEAMPASFQAIYTPVESAGTEAQIKHLARLMATQMTAAGLGPGVEQTKQCKEEPKEEKVVKTESVLIKRRLSAQGQAISVVGSLSSMSPLEEEAPQAKRRPEPIIPVTQPRLAGAGGRKKIFRLSDVLKPLTDAQVEAMKLGAVKRILRAEKAVACSGAAQVRIKILASLVTQFNSGLKAEVLSFILEDVRARLDLAFAWLYQEYNAYLAAGASGSLDKYEDCLIRLLSGLQEKPDQKDGIFTKVVLEAPLITESALEVVRKYCEDESRTYLGMSTLRDLIFKRPSRQFQYLHVLLDLSSHEKDKVRSQALLFIKRMYEKEQLREYVEKFALNYLQLLVHPNPPSVLFGADKDTEVAAPWTEETVKQCLYLYLALLPQNHKLIHELAAVYTEAIADIKRTVLRVIEQPIRGMGMNSPELLLLVENCPKGAETLVTRCLHSLTDKVPPSPELVKRVRDLYHKRLPDVRFLIPVLNGLEKKEVIQALPKLIKLNPIVVKEVFNRLLGTQHGEGNSALSPLNPGELLIALHNIDSVKCDMKSIIKATNLCFAERNVYTSEVLAVVMQQLMEQSPLPMLLMRTVIQSLTMYPRLGGFVMNILSRLIMKQVWKYPKVWEGFIKCCQRTKPQSFQVILQLPPQQLGAVFDKCPELREPLLAHVRSFTPHQQAHIPNSIMTILEASGKQEPEAKEAPAGPLEEDDLEPLTLAPAPAPRPPQDLIGLRLAQEKALKRQLEEEQKLKPGGVGAPSSSSPSPSPSARPGPPPSEEAMDFREEGPECETPGIFISMDDDSGLTEAALLDSSLEGPLPKETAAGGLTLKEERSPQTLAPVGEDAMKTPSPAAEDAREPEAKGNS
"
misc_feature 246..617
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q92797.2);
Region: Interaction with HSF1"
misc_feature 555..683
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q92797.2);
Region: HEAT 3"
misc_feature 600..1301
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/note="Domain of unknown function (DUF3453); Region:
DUF3453; pfam11935"
/db_xref="CDD:192887"
misc_feature 702..821
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q92797.2);
Region: HEAT 4"
misc_feature 924..1043
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q92797.2);
Region: HEAT 5"
misc_feature 1278..1325
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q92797.2);
Region: Nuclear localization signal (Potential)"
misc_feature 1725..1727
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q92797.2); phosphorylation site"
misc_feature 2904..3452
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/note="Symplekin tight junction protein C terminal;
Region: Symplekin_C; pfam12295"
/db_xref="CDD:152730"
misc_feature 3972..3974
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q92797.2); phosphorylation site"
misc_feature 3972..3974
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 4014..4016
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (Q92797.2); phosphorylation site"
misc_feature 4020..4022
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q92797.2); phosphorylation site"
exon 351..416
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
exon 417..470
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
exon 471..544
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
exon 545..671
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
variation 557
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/replace="c"
/replace="t"
/db_xref="dbSNP:2303014"
exon 672..921
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
variation 692
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/replace="a"
/replace="c"
/db_xref="dbSNP:3206292"
exon 922..1092
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
exon 1093..1332
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
exon 1333..1487
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
exon 1488..1638
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
exon 1639..1843
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
exon 1844..1994
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
exon 1995..2230
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
exon 2231..2312
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
exon 2313..2426
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
exon 2427..2574
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
exon 2575..2735
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
exon 2736..2844
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
exon 2845..2945
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
exon 2946..3036
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
exon 3037..3138
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
exon 3139..3326
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
exon 3327..3503
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
exon 3504..3599
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
exon 3600..3932
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
variation 3626
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/replace="c"
/replace="g"
/db_xref="dbSNP:1132645"
exon 3933..4188
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/inference="alignment:Splign:1.39.8"
STS 3952..4072
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/standard_name="RH11655"
/db_xref="UniSTS:35107"
variation 3993
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/replace="c"
/replace="g"
/db_xref="dbSNP:1804616"
variation 4089
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/replace="c"
/replace="g"
/db_xref="dbSNP:3810332"
variation 4129
/gene="SYMPK"
/gene_synonym="SPK; SYM"
/replace=""
/replace="ggacggggcgggg"
/db_xref="dbSNP:3840933"
polyA_signal 4161..4166
/gene="SYMPK"
/gene_synonym="SPK; SYM"
polyA_site 4188
/gene="SYMPK"
/gene_synonym="SPK; SYM"
ORIGIN
ggaaatgaagggtctgctcgccgtagtatggaggcgggcagaatgccgctcgcacgggacgaggcatgggcggggtcgggctgtgctctggactccatttcccggcggccctgggtgtgtggcgcgtgcgcaccgttcccggcgacgaacggaagatggcggcggcggcggcggcggagtgtaggaagaggcactgctgagggggcgcgaggggaacggaggccagagctgcgctgacagcagccatggcgagcggcagtggagacagcgtcacccgtcggagcgtggcatcacagtttttcactcaagaggaggggccgggcatcgatggcatgaccacctcagagagggtggtggatcttctgaaccaggcggcgctgatcaccaatgactcaaagatcacagtgctcaaacaggtccaggagctgatcatcaacaaagaccccacactactggacaacttcctggatgagatcatcgcattccaagcagacaagtcaatcgaagtgcgaaaatttgtcatcggcttcatcgaggaggcatgcaagcgagacattgagttgctgctgaaactcattgcaaacctcaacatgctcttgagggacgagaatgtgaacgtggtgaagaaggctatcctcaccatgacccagctctacaaggtggccctgcagtggatggtaaagtcacgggtcattagcgagctacaggaggcctgctgggacatggtatctgccatggcgggggacatcatcctgctattggactctgacaatgacggcatccgcacccacgccatcaagtttgtggagggcctcattgtcaccctgtcaccccgcatggctgactcagagataccccgacgccaggagcatgatatcagcctggaccgcatccctcgtgaccacccctacatccagtacaacgtgctatgggaagagggcaaggcagccttggagcagctgcttaagttcatggtgcaccctgccatctcctccatcaacctgaccacagcgctgggctcccttgccaatatcgcccgccagagacccatgttcatgtctgaggtgatccaggcctatgaaactctgcatgccaacctgcccccgacgctggccaaatcgcaggtgagcagtgtgcgtaagaatctgaagctgcacctgttgagtgtgctgaagcacccggcttccttggagttccaggcccagatcaccaccctgctggtggacctgggcacacctcaggccgagatcgcccgcaacatgccgagcagcaaggacacccgcaagcggccccgcgatgactcggactccacactcaagaagatgaagctggagcccaacctgggggaggacgatgaggacaaagacttggagccaggcccgtcggggacctcgaaggcctcagcgcagatctccggccagtcagacacggacatcacagctgagttcctgcagcctctgctgacgcctgataatgtggctaatctggtcctcatcagcatggtgtacctacccgaggccatgccagcctccttccaggccatctacacccccgtggagtcagcaggcacggaagcccagatcaagcacctggctcggctcatggccacacagatgacagctgccggactgggaccaggtgtagagcagaccaaacagtgcaaggaggagcccaaggaggagaaggtggtgaagacagagagcgtcctgatcaagcggcgcctgtcagcccagggccaagccatctcggtggtgggttccctgagctccatgtcccccctggaggaagaggcaccgcaggccaagaggaggccagagcccattatccctgtcactcagccccggctggcaggcgctggtgggcgcaagaaaattttccgtctcagcgacgtgctgaagccccttaccgatgcccaggtggaagccatgaagctgggcgctgtgaagcggatcctgcgggctgagaaggctgtggcctgcagcggggcagcccaggtccgcataaagatcctggccagcctggtgacacagttcaactcgggcctgaaggcggaggtcctgtccttcatcctggaggatgtgcgggcccgcctggacctggccttcgcctggctctaccaggagtacaacgcctacctggccgcaggtgcctcgggctccctggacaagtatgaggactgcctcatccgcctgttgtctggcctgcaggagaaaccagaccagaaggatgggatcttcaccaaggttgtgctggaggcgccactcatcacagagagtgccctggaggtggtccgcaagtactgcgaggatgagagtcgcacctatctgggcatgtccacacttcgagacctgatcttcaagcgcccgtcccgccagttccagtacctgcatgtcctcctcgacctcagctcccatgagaaggacaaggtgcgctcccaggccctgctgttcatcaaacgcatgtatgagaaggagcagctgcgggagtatgtggagaaatttgccctcaactacctgcagctcctggtgcaccccaacccaccgtctgtgctgtttggagctgacaaggacacagaggtggcagcaccctggacggaggagacagtgaagcagtgtctgtacctctacctggccctcctgcctcagaaccacaagctgatccacgaactggcggccgtgtacactgaagccatcgccgacatcaagcggacggtgctgagggtcattgagcagccgatccgaggaatgggcatgaactccccggagctgctcctgctggtggaaaattgtcccaagggagcagagacactggtcacgagatgtctgcacagcctcacagacaaagtcccaccctccccagagctggtgaagcgggtccgggatctctaccacaagcgactgccagacgtccgcttcctcatcccggtgctcaatgggctggagaagaaagaggtgatccaggccctgcctaaactcatcaaactcaaccccatcgtggtgaaggaagtcttcaaccgcctgctgggcacccagcatggtgagggaaactcagccttgtccccgctgaaccctggagagctcctgatcgcattacacaacattgactccgtgaagtgcgacatgaaatccatcatcaaagccaccaacctgtgctttgcggagcggaacgtgtacacgtcagaggtgctggccgtggtgatgcagcagctgatggagcagagccccctgcccatgctgctcatgaggaccgtcatccagtccctgaccatgtacccccgcctggggggcttcgtcatgaacatcctgtcccgcctcatcatgaagcaggtgtggaagtaccccaaggtgtgggagggcttcatcaagtgctgccagcgcacaaagccccagagcttccaggtcatcctgcagctgccgccccagcagctgggagccgtctttgacaagtgcccagagctccgggagcccctgctggcccatgtccgctccttcaccccccaccagcaagctcacatccctaactccatcatgaccatcttggaggccagcggcaagcaggagccagaggccaaggaggcgcctgcggggcccttggaggaggatgatctggagcccctgaccttggccccggccccagcaccccggccccctcaggacctcatcggcctgcgactggcccaggagaaggccttaaagcggcagctggaggaggaacagaagctgaagccgggaggagtgggagccccctcctcttcctccccctctccctctccgtcggcccggccaggcccgcccccgtctgaggaagccatggatttccgggaggaggggcctgagtgcgagaccccgggcatcttcatcagcatggatgacgactcggggctgaccgaggccgcgctgttggactctagtctcgagggccccctacccaaggagacggcagcgggcgggctgaccttgaaggaggagcggagcccccagaccctcgcacctgttggagaagatgctatgaagactcccagcccggctgccgaggacgccagggaacccgaggccaaggggaacagctgacggggctcgagggggaaagggggtgggacagggactcggggctgggggacggggcggggcttgacctgcgggtgctttgccttaaaaagaaataaaagatgtgaacttgggcaagtta
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:8189 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:8189 -> Biological process: GO:0006378 [mRNA polyadenylation] evidence: IMP
GeneID:8189 -> Biological process: GO:0007155 [cell adhesion] evidence: IEA
GeneID:8189 -> Biological process: GO:0035307 [positive regulation of protein dephosphorylation] evidence: IDA
GeneID:8189 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:8189 -> Cellular component: GO:0005654 [nucleoplasm] evidence: IDA
GeneID:8189 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
GeneID:8189 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:8189 -> Cellular component: GO:0005856 [cytoskeleton] evidence: IEA
GeneID:8189 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
GeneID:8189 -> Cellular component: GO:0005923 [tight junction] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.