GGRNA | NM_001185117.1

LOCUS       NM_001185117            3517 bp    mRNA    linear   PRI 24-JUN-2013
DEFINITION  Homo sapiens claudin 19 (CLDN19), transcript variant 3, mRNA.
ACCESSION   NM_001185117
VERSION     NM_001185117.1  GI:297515501
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3517)
  AUTHORS   Al-Shibli,A., Konrad,M., Altay,W., Al Masri,O., Al-Gazali,L. and Al
            Attrach,I.
  TITLE     Familial hypomagnesemia with hypercalciuria and nephrocalcinosis
            (FHHNC): report of three cases with a novel mutation in CLDN19 gene
  JOURNAL   Saudi J Kidney Dis Transpl 24 (2), 338-344 (2013)
   PUBMED   23538362
  REMARK    GeneRIF: Case Reports: novel CLDN19 mutation in familial
            hypomagnesemia with hypercalciuria and nephrocalcinosis.
REFERENCE   2  (bases 1 to 3517)
  AUTHORS   Godron,A., Harambat,J., Boccio,V., Mensire,A., May,A.,
            Rigothier,C., Couzi,L., Barrou,B., Godin,M., Chauveau,D.,
            Faguer,S., Vallet,M., Cochat,P., Eckart,P., Guest,G., Guigonis,V.,
            Houillier,P., Blanchard,A., Jeunemaitre,X. and Vargas-Poussou,R.
  TITLE     Familial hypomagnesemia with hypercalciuria and nephrocalcinosis:
            phenotype-genotype correlation and outcome in 32 patients with
            CLDN16 or CLDN19 mutations
  JOURNAL   Clin J Am Soc Nephrol 7 (5), 801-809 (2012)
   PUBMED   22422540
  REMARK    GeneRIF: The risk of end-stage renal disease in patients with
            CLDN19 mutations was two times the risk of patients with CLDN16
            mutations. Ocular abnormalities were observed only in patients with
            CLDN19 mutations.
REFERENCE   3  (bases 1 to 3517)
  AUTHORS   Ekinci,Z., Karabas,L. and Konrad,M.
  TITLE     Hypomagnesemia-hypercalciuria-nephrocalcinosis and ocular findings:
            a new claudin-19 mutation
  JOURNAL   Turk. J. Pediatr. 54 (2), 168-170 (2012)
   PUBMED   22734304
  REMARK    GeneRIF: In a patient with consanguineous parents, history of
            disturbed organization and development of the retina, a diagnosis
            of Familial hypomagnesemia with hypercalciuria and nephrocalcinosis
            caused by claudin-19 mutation should be considered.
REFERENCE   4  (bases 1 to 3517)
  AUTHORS   Faguer,S., Chauveau,D., Cintas,P., Tack,I., Cointault,O.,
            Rostaing,L., Vargas-Poussou,R. and Ribes,D.
  TITLE     Renal, ocular, and neuromuscular involvements in patients with
            CLDN19 mutations
  JOURNAL   Clin J Am Soc Nephrol 6 (2), 355-360 (2011)
   PUBMED   21030577
  REMARK    GeneRIF: Ocular manifestations and exercise intolerance mimicking
            mild to moderate periodic paralysis are two symptoms that may occur
            in patients with familial hypomagnesemia with hypercalciuria and
            nephrocalcinosis and may indicate CLDN19 mutations.
REFERENCE   5  (bases 1 to 3517)
  AUTHORS   Lal-Nag,M. and Morin,P.J.
  TITLE     The claudins
  JOURNAL   Genome Biol. 10 (8), 235 (2009)
   PUBMED   19706201
  REMARK    Review article
REFERENCE   6  (bases 1 to 3517)
  AUTHORS   Gonzalez-Mariscal,L., Betanzos,A., Nava,P. and Jaramillo,B.E.
  TITLE     Tight junction proteins
  JOURNAL   Prog. Biophys. Mol. Biol. 81 (1), 1-44 (2003)
   PUBMED   12475568
  REMARK    Review article
REFERENCE   7  (bases 1 to 3517)
  AUTHORS   Tsukita,S. and Furuse,M.
  TITLE     Claudin-based barrier in simple and stratified cellular sheets
  JOURNAL   Curr. Opin. Cell Biol. 14 (5), 531-536 (2002)
   PUBMED   12231346
  REMARK    Review article
REFERENCE   8  (bases 1 to 3517)
  AUTHORS   Tsukita,S., Furuse,M. and Itoh,M.
  TITLE     Multifunctional strands in tight junctions
  JOURNAL   Nat. Rev. Mol. Cell Biol. 2 (4), 285-293 (2001)
   PUBMED   11283726
  REMARK    Review article
REFERENCE   9  (bases 1 to 3517)
  AUTHORS   Heiskala,M., Peterson,P.A. and Yang,Y.
  TITLE     The roles of claudin superfamily proteins in paracellular transport
  JOURNAL   Traffic 2 (2), 93-98 (2001)
   PUBMED   11247307
  REMARK    Review article
REFERENCE   10 (bases 1 to 3517)
  AUTHORS   Kniesel,U. and Wolburg,H.
  TITLE     Tight junctions of the blood-brain barrier
  JOURNAL   Cell. Mol. Neurobiol. 20 (1), 57-76 (2000)
   PUBMED   10690502
  REMARK    Review article
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AK096063.1, AK298992.1 and
            AC098484.2.
            
            Summary: The product of this gene belongs to the claudin family. It
            plays a major role in tight junction-specific obliteration of the
            intercellular space, through calcium-independent cell-adhesion
            activity. Defects in this gene are the cause of hypomagnesemia
            renal with ocular involvement (HOMGO). HOMGO is a progressive renal
            disease characterized by primary renal magnesium wasting with
            hypomagnesemia, hypercalciuria and nephrocalcinosis associated with
            severe ocular abnormalities such as bilateral chorioretinal scars,
            macular colobomata, significant myopia and nystagmus. Alternatively
            spliced transcript variants encoding distinct isoforms have been
            identified for this gene. [provided by RefSeq, Jun 2010].
            
            Transcript Variant: This variant (3) lacks an exon in the CDS,
            which results in frame-shift, and contains an additional segment in
            the 3' region compared to variant 1. The resulting isoform (c) is
            shorter and has a distinct C-terminus compared to isoform a.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK298992.1 [ECO:0000332]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-24                AK096063.1         1-24
            25-746              AK298992.1         4-725
            747-1586            AC098484.2         83002-83841         c
            1587-3517           AC098484.2         81071-83001         c
FEATURES             Location/Qualifiers
     source          1..3517
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1p34.2"
     gene            1..3517
                     /gene="CLDN19"
                     /gene_synonym="HOMG5"
                     /note="claudin 19"
                     /db_xref="GeneID:149461"
                     /db_xref="HGNC:2040"
                     /db_xref="MIM:610036"
     exon            1..414
                     /gene="CLDN19"
                     /gene_synonym="HOMG5"
                     /inference="alignment:Splign:1.39.8"
     CDS             192..848
                     /gene="CLDN19"
                     /gene_synonym="HOMG5"
                     /note="isoform c is encoded by transcript variant 3;
                     claudin-19"
                     /codon_start=1
                     /product="claudin-19 isoform c"
                     /protein_id="NP_001172046.1"
                     /db_xref="GI:297515502"
                     /db_xref="CCDS:CCDS53306.1"
                     /db_xref="GeneID:149461"
                     /db_xref="HGNC:2040"
                     /db_xref="MIM:610036"
                     /translation="

MANSGLQLLGYFLALGGWVGIIASTALPQWKQSSYAGDAIITAVGLYEGLWMSCASQSTGQVQCKLYDSLLALDGHIQSARALMVVAVLLGFVAMVLSVVGMKCTRVGDSNPIAKGRVAIAGGALFILAGMNLAQPCSWAGPQLAWPCWAAPSSAAHARSQRDPTAAHSPIGLDPLLLPESTSELRLPWPAPHPVAPLPSIQPASQHPGQGHWGIGWA

"
     misc_feature    201..>515
                     /gene="CLDN19"
                     /gene_synonym="HOMG5"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; cl15797"
                     /db_xref="CDD:210197"
     exon            415..579
                     /gene="CLDN19"
                     /gene_synonym="HOMG5"
                     /inference="alignment:Splign:1.39.8"
     variation       468
                     /gene="CLDN19"
                     /gene_synonym="HOMG5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34374110"
     exon            580..3517
                     /gene="CLDN19"
                     /gene_synonym="HOMG5"
                     /inference="alignment:Splign:1.39.8"
ORIGIN

attctggagtccagagccactgcctttgctccagccgctgccgccgcaccacctctccttctctgcctctgaccctccttctcgctgctccccctgcccagctgctcctcccacctggccatgaccaaagcccctgctggcaccctggcccagctctgagtcctgggaccctcggtcctctctcctgggccatggccaactcaggcctccagctcctgggctacttcttggccctgggtggctgggtgggcatcattgctagcacagccctgccacagtggaagcagtcttcctacgcaggcgacgccatcatcactgccgtgggcctctatgaagggctctggatgtcctgcgcctcccagagcactgggcaagtgcagtgcaagctctacgactcgctgctcgccctggacggtcacatccaatcagcgcgggccctgatggtggtggccgtgctcctgggcttcgtggccatggtcctcagcgtagttggcatgaagtgtacgcgggtgggagacagcaaccccattgccaagggccgtgttgccatcgccgggggagccctcttcatcctggcaggtatgaatttggcccagccctgttcgtgggctgggcctcagctggcctggccgtgctgggcggctccttcctctgctgcacatgcccggagccagagagacccaacagcagcccacagccctatcggcctggaccctctgctgctgcccgagagtacgtctgagctccgcctgccctggccagccccccacccagtggcccccttgcccagcatccagccagcctcgcagcaccctgggcagggccactggggcataggatgggcataggtgctctgagcagcttgtcctcaacacaagcacccaccctgcaatctgagacccagatcctcagagagacaccagaggcaggacccagcccccaggcatacacacagatgcaggtccaggcacggtcttgtctgcacagcctggtgggcaccagcatgcatccctggagacaggccctcaggcaccagcccggctgtttactcactgaagagctgcttgggtgtctgctacgtgctgggccctagagatagagcagtggccaagacgtaccttagtacccaggtccttggggtgagcagaaaccttcaccctccccagtcccatgggctcctcacagcaaccccacaagggcagtgccgggatgctgaacgttcacacaaggacagggagggtctgagtttaggtctcaggttcttccagtgcgcccagggctgggggccacctacacagatggtgaggtcggaccatggcgcccctgcccccgggaatgggccccaggcagggctgctgtgagggccaaggtctggccacgctggccagtacccatgtccgggcctgaatgcacagcccctgcccccgaccccacagctcactccactaaccagctctctctcttttgactttcagaccagttgttaaattgcccgcctccgccaagggccccctgggtgtgtaatgtccagtccccagccaggctctgtcccctgccatacctagactgtgtgtttcatatttttttggaaagagaagtgaacatccagccccaatcatggtatcattcggtctgtcctcagcgtggcttggacggggcctgtgtcagagtggtcagtgctgacccctggggctcttgggcagaaagatgaggagacagaggtccagggtgggttacatagcacatccagggctaagcaagaaataattcagaggtcctaccctctgtctagggacccccctcccaagcctggccttggccttggcacaaagtcctccttgataggagatcccactcactcctggaggctgcccctgaggcttggcccagctctaggagcagtccccagggtcagggagcccctggtgtggaaagaggccccaaggtagtaaaccctgcccctgttactgtgctccagagacctcctaagggaagggacagttcctggaaggccctccagctggatgctggggatcagcgataggtgaggggacacagtgtaggagctccccatgtagaaaagggaatgtggggagggcgttaggagcttgcaggcattaggactgtcctgagcaaggtctgcagcccccagctctgctcaccccgaatcctgccccttgtttccacacctaccattcctcctctcctgatccccagcatccagctgaggtccaaggtctttgtcctagaatcagagtggggaggggacagcctggggctgcccagagactgtgggtggagctgcctgctgcactcagcagtgcggtcagagaagggcttttggtcttgaagtccaggtaccatccccccttagcatacagggggaagggcctgagaggaatgtaaggaaaccagcccagatcagtcccaaggccagagtcctttgtcctacatctccctgaaccagagtgtgccctgcccctcatgctcagacctctcccaccccaaaccctctcccgggactcagtctccctggccactgcgtatcaggcttctggggaaagcatccatcacagaacctccccttccctgccacgcaccttccttggccagctccattctggcctcctccaccacctgccttgtgaccacatctcccaccacgtccccagatctcaagaacgcagctcagcttctccttcgagcttgactctgagagggaaagtgacggaaaccaagtcagatgagatgactgccatgtacactgcagtcaagggcagggaggggaggaatgacacaaatggcagggagctgctgggggactgacccctcggcgcctggcctggccggtgctgcacatccaccggggcacaacagggacttgtccagcctctggtcagaggatgtggccacctgaccctaaataggttccccagagtcctgcccctctaatgaatgagaactgcaggagtttctcctctgggtgcctgaagctatagtgcaatggttcccaaccctgcatgcacattcgaatcacctgggggcacaatgcctaggctccaaccccagacactcttatttcattggtctgggtggacctggcatcagaagtcatgtagctcctcaggggactgtagtgtgtggtcagcactgagggctcctctatgaggcctcaagcccaggtgactctgtgaggtctgcagagggagaaaagaacccacaagggaagaggtggaggtcaggcacggtggctcacgcttgtaatcccagcactttgggaggccgaggtgggtagatacctgaagtcaggagttcgagactagcctggccaatatggtaaaaccccgtgtctattaaaaatacaaaaattagctggctgtggtggtgggcacctgtaatcccagctactcgggaggctgaggcaggagaatcgcttgaactcgggaggtggaggttgcagtcagccaagatcgtgccactgcacaccatcctggatgacagagcaagactccatcac

//

Annotations: