LOCUS       NM_001001346            1209 bp    mRNA    linear   PRI 14-APR-2013
DEFINITION  Homo sapiens claudin 20 (CLDN20), mRNA.
ACCESSION   NM_001001346
VERSION     NM_001001346.3  GI:297591810
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1209)
  AUTHORS   Lal-Nag,M. and Morin,P.J.
  TITLE     The claudins
  JOURNAL   Genome Biol. 10 (8), 235 (2009)
   PUBMED   19706201
  REMARK    Review article
REFERENCE   2  (bases 1 to 1209)
  AUTHORS   Angelow,S., Ahlstrom,R. and Yu,A.S.
  TITLE     Biology of claudins
  JOURNAL   Am. J. Physiol. Renal Physiol. 295 (4), F867-F876 (2008)
   PUBMED   18480174
  REMARK    Review article
REFERENCE   3  (bases 1 to 1209)
  AUTHORS   Krause,G., Winkler,L., Mueller,S.L., Haseloff,R.F., Piontek,J. and
            Blasig,I.E.
  TITLE     Structure and function of claudins
  JOURNAL   Biochim. Biophys. Acta 1778 (3), 631-645 (2008)
   PUBMED   18036336
  REMARK    Review article
REFERENCE   4  (bases 1 to 1209)
  AUTHORS   Lamesch,P., Li,N., Milstein,S., Fan,C., Hao,T., Szabo,G., Hu,Z.,
            Venkatesan,K., Bethel,G., Martin,P., Rogers,J., Lawlor,S.,
            McLaren,S., Dricot,A., Borick,H., Cusick,M.E., Vandenhaute,J.,
            Dunham,I., Hill,D.E. and Vidal,M.
  TITLE     hORFeome v3.1: a resource of human open reading frames representing
            over 10,000 human genes
  JOURNAL   Genomics 89 (3), 307-315 (2007)
   PUBMED   17207965
REFERENCE   5  (bases 1 to 1209)
  AUTHORS   Rizzolo,L.J., Chen,X., Weitzman,M., Sun,R. and Zhang,H.
  TITLE     Analysis of the RPE transcriptome reveals dynamic changes during
            the development of the outer blood-retinal barrier
  JOURNAL   Mol. Vis. 13, 1259-1273 (2007)
   PUBMED   17679949
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 1209)
  AUTHORS   Tsukita,S. and Furuse,M.
  TITLE     Claudin-based barrier in simple and stratified cellular sheets
  JOURNAL   Curr. Opin. Cell Biol. 14 (5), 531-536 (2002)
   PUBMED   12231346
  REMARK    Review article
REFERENCE   7  (bases 1 to 1209)
  AUTHORS   Tsukita,S., Furuse,M. and Itoh,M.
  TITLE     Multifunctional strands in tight junctions
  JOURNAL   Nat. Rev. Mol. Cell Biol. 2 (4), 285-293 (2001)
   PUBMED   11283726
  REMARK    Review article
REFERENCE   8  (bases 1 to 1209)
  AUTHORS   Heiskala,M., Peterson,P.A. and Yang,Y.
  TITLE     The roles of claudin superfamily proteins in paracellular transport
  JOURNAL   Traffic 2 (2), 93-98 (2001)
   PUBMED   11247307
  REMARK    Review article
REFERENCE   9  (bases 1 to 1209)
  AUTHORS   Kniesel,U. and Wolburg,H.
  TITLE     Tight junctions of the blood-brain barrier
  JOURNAL   Cell. Mol. Neurobiol. 20 (1), 57-76 (2000)
   PUBMED   10690502
  REMARK    Review article
REFERENCE   10 (bases 1 to 1209)
  AUTHORS   Berg,M., Geisel,A. and Necheles,H.
  TITLE     The influence of carbenoxolone on steroid-induced ulcer and mucus
            secretion in the rat
  JOURNAL   Am J Dig Dis 20 (2), 134-137 (1975)
   PUBMED   1124737
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BC020838.1 and AL139101.13.
            On Jun 5, 2010 this sequence version replaced gi:141802068.
            
            Summary: This gene encodes a member of the claudin family. Claudins
            are integral membrane proteins and components of tight junction
            strands. Tight junction strands serve as a physical barrier to
            prevent solutes and water from passing freely through the
            paracellular space between epithelial or endothelial cell sheets,
            and also play critical roles in maintaining cell polarity and
            signal transductions. [provided by RefSeq, Jun 2010].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC020838.1, BF571834.1 [ECO:0000332]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1206              BC020838.1         2-1207
            1207-1209           AL139101.13        20674-20676
FEATURES             Location/Qualifiers
     source          1..1209
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="6"
                     /map="6q25"
     gene            1..1209
                     /gene="CLDN20"
                     /note="claudin 20"
                     /db_xref="GeneID:49861"
                     /db_xref="HGNC:2042"
                     /db_xref="HPRD:13067"
     exon            1..276
                     /gene="CLDN20"
                     /inference="alignment:Splign:1.39.8"
     variation       2
                     /gene="CLDN20"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377429705"
     variation       8
                     /gene="CLDN20"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11966646"
     variation       87
                     /gene="CLDN20"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9397236"
     variation       132
                     /gene="CLDN20"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2985700"
     variation       152
                     /gene="CLDN20"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115669602"
     variation       179
                     /gene="CLDN20"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:9480098"
     variation       251
                     /gene="CLDN20"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192967460"
     exon            277..1209
                     /gene="CLDN20"
                     /inference="alignment:Splign:1.39.8"
     variation       332
                     /gene="CLDN20"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:375801323"
     variation       347
                     /gene="CLDN20"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371022261"
     misc_feature    354..356
                     /gene="CLDN20"
                     /note="upstream in-frame stop codon"
     variation       364
                     /gene="CLDN20"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370497394"
     variation       379
                     /gene="CLDN20"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199579197"
     CDS             381..1040
                     /gene="CLDN20"
                     /note="claudin-20"
                     /codon_start=1
                     /product="claudin-20 precursor"
                     /protein_id="NP_001001346.1"
                     /db_xref="GI:47716519"
                     /db_xref="CCDS:CCDS5249.1"
                     /db_xref="GeneID:49861"
                     /db_xref="HGNC:2042"
                     /db_xref="HPRD:13067"
                     /translation="

MASAGLQLLAFILALSGVSGVLTATLLPNWKVNVDVDSNIITAIVQLHGLWMDCTWYSTGMFSCALKHSILSLPIHVQAARATMVLACVLSALGICTSTVGMKCTRLGGDRETKSHASFAGGVCFMSAGISSLISTVWYTKEIIANFLDLTVPESNKHEPGGAIYIGFISAMLLFISGMIFCTSCIKRNPEARLDPPTQQPISNTQLENNSTHNLKDYV

"
     sig_peptide     381..440
                     /gene="CLDN20"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     misc_feature    393..923
                     /gene="CLDN20"
                     /note="PMP-22/EMP/MP20/Claudin family; Region:
                     PMP22_Claudin; cl15797"
                     /db_xref="CDD:210197"
     misc_feature    402..464
                     /gene="CLDN20"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P56880.1);
                     transmembrane region"
     misc_feature    624..686
                     /gene="CLDN20"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P56880.1);
                     transmembrane region"
     misc_feature    735..797
                     /gene="CLDN20"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P56880.1);
                     transmembrane region"
     misc_feature    861..923
                     /gene="CLDN20"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P56880.1);
                     transmembrane region"
     variation       382
                     /gene="CLDN20"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201732989"
     variation       391
                     /gene="CLDN20"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:112008767"
     variation       413
                     /gene="CLDN20"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367601594"
     variation       424
                     /gene="CLDN20"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201230000"
     variation       428
                     /gene="CLDN20"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:927718"
     variation       436
                     /gene="CLDN20"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191128847"
     variation       454
                     /gene="CLDN20"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370423337"
     variation       495
                     /gene="CLDN20"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142319064"
     variation       504..505
                     /gene="CLDN20"
                     /replace=""
                     /replace="aaccc"
                     /db_xref="dbSNP:372660394"
     variation       517
                     /gene="CLDN20"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375461196"
     variation       524
                     /gene="CLDN20"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372008756"
     variation       525
                     /gene="CLDN20"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201768355"
     variation       532
                     /gene="CLDN20"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:116971953"
     variation       542
                     /gene="CLDN20"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201831727"
     variation       544
                     /gene="CLDN20"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372413050"
     variation       595
                     /gene="CLDN20"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139854187"
     variation       608
                     /gene="CLDN20"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375435637"
     variation       619
                     /gene="CLDN20"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141689255"
     variation       637
                     /gene="CLDN20"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144781507"
     variation       640
                     /gene="CLDN20"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201661997"
     variation       641
                     /gene="CLDN20"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114329733"
     variation       650
                     /gene="CLDN20"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142924023"
     variation       660
                     /gene="CLDN20"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112181141"
     variation       661
                     /gene="CLDN20"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34434986"
     variation       674
                     /gene="CLDN20"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1555774"
     variation       722
                     /gene="CLDN20"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150441263"
     variation       728
                     /gene="CLDN20"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141640357"
     variation       732
                     /gene="CLDN20"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:116763699"
     variation       734..735
                     /gene="CLDN20"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35655837"
     variation       742
                     /gene="CLDN20"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199712922"
     variation       786
                     /gene="CLDN20"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:145250061"
     variation       809
                     /gene="CLDN20"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148869864"
     variation       815
                     /gene="CLDN20"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143560527"
     variation       834
                     /gene="CLDN20"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374979138"
     variation       837
                     /gene="CLDN20"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200032175"
     variation       877
                     /gene="CLDN20"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148057067"
     variation       878
                     /gene="CLDN20"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200362086"
     variation       926
                     /gene="CLDN20"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199823828"
     variation       934
                     /gene="CLDN20"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142691738"
     variation       936
                     /gene="CLDN20"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372674683"
     variation       962
                     /gene="CLDN20"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138139364"
     variation       1001
                     /gene="CLDN20"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149570827"
     variation       1002
                     /gene="CLDN20"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368500699"
     variation       1023
                     /gene="CLDN20"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:6941874"
     variation       1059
                     /gene="CLDN20"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147319822"
     variation       1075
                     /gene="CLDN20"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375362798"
     variation       1098..1099
                     /gene="CLDN20"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:200044619"
     variation       1107..1108
                     /gene="CLDN20"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:11397048"
     variation       1171
                     /gene="CLDN20"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6925410"
     polyA_signal    1187..1192
                     /gene="CLDN20"
     variation       1195
                     /gene="CLDN20"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77018521"
     polyA_site      1209
                     /gene="CLDN20"
ORIGIN      

aaagttcgaagtgggatgatcacgggcagacctgggtggttgggaacaggaagcatatggcatcttgcaggctataggcaccacaaaatggaacgcaggaggacaggggcttgggagagccacttcactgtcgggtaaaacaacggagcaagatgagtgcctccggatgcttggtttccccaccctccagtgtctgcttgctcttcaagtacctccaccaagctaatgacagtccactttaggacatcacgggcctcgaggttacaactttcccaggctttgttatttggttctctactgcacagaaatagatagaattctgacagccatcattgttaaacatcaggattttctaagaggacagacttaacagtaacatcatggcctcagcaggactccagctccttgctttcatcctggccttatctggggtctctggagtgctcacagccactctgctgcccaactggaaggtgaatgtggatgtggactccaacatcataacagccattgtacagctgcacgggctctggatggactgtacgtggtacagcactgggatgttcagctgtgccctgaaacactccattctgtccctccccatccacgtgcaggctgcgagagccaccatggtcctggcgtgtgttctgtctgctttggggatctgcacttccacagtaggaatgaaatgtactcgcttaggaggggacagagaaaccaagagccatgcttcctttgctggaggagtctgtttcatgtctgcaggaatctctagtttaatctcgacagtgtggtacacaaaggagatcatagcaaactttctggatctgacagttccagaaagcaacaaacatgaacctggaggagctatctatatcggattcatttctgcaatgctgttgtttatctctggcatgattttctgcacctcctgtataaaaaggaatccagaagctagactcgacccacccacacagcagcctatctctaacacacagctcgagaacaattccacacacaatctgaaggattatgtgtaaataactgagtaatgcatatgaaatggaacttttgggtgccaaatgggacttttagattaaaaaaaaatcagaattatgcttaactttccctacaaagaaagtagaatgtaaaatactttaacaactacaaagtagtttaaaatgccaataaaactatcatatacaatta

//

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:49861 -> Molecular function: GO:0005198 [structural molecule activity] evidence: IEA
            GeneID:49861 -> Molecular function: GO:0042802 [identical protein binding] evidence: ISS
            GeneID:49861 -> Biological process: GO:0016338 [calcium-independent cell-cell adhesion] evidence: ISS
            GeneID:49861 -> Biological process: GO:0034329 [cell junction assembly] evidence: TAS
            GeneID:49861 -> Biological process: GO:0045216 [cell-cell junction organization] evidence: TAS
            GeneID:49861 -> Biological process: GO:0070830 [tight junction assembly] evidence: TAS
            GeneID:49861 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA
            GeneID:49861 -> Cellular component: GO:0005923 [tight junction] evidence: ISS
            GeneID:49861 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA