GGRNA Home | Help | Advanced search

2025-05-09 19:02:46, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_201437               2721 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens transcription elongation factor A (SII), 1 (TCEA1),
            transcript variant 2, mRNA.
ACCESSION   NM_201437 XM_936974 XM_943119
VERSION     NM_201437.1  GI:45439354
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2721)
  AUTHORS   Shema,E., Kim,J., Roeder,R.G. and Oren,M.
  TITLE     RNF20 inhibits TFIIS-facilitated transcriptional elongation to
            suppress pro-oncogenic gene expression
  JOURNAL   Mol. Cell 42 (4), 477-488 (2011)
   PUBMED   21596312
  REMARK    GeneRIF: RNF20, presumably via H2Bub, selectively represses
            oncogenic genes by interfering with chromatin recruitment of TFIIS,
            a factor capable of relieving stalled RNA polymerase II. RNF20
            inhibits the interaction between TFIIS and the PAF1 complex.
REFERENCE   2  (bases 1 to 2721)
  AUTHORS   Mackinnon-Roy,C., Stubbert,L.J. and McKay,B.C.
  TITLE     RNA interference against transcription elongation factor SII does
            not support its role in transcription-coupled nucleotide excision
            repair
  JOURNAL   Mutat. Res. 706 (1-2), 53-58 (2011)
   PUBMED   21070792
  REMARK    GeneRIF: Results indicate that TFIIS is not limiting for the repair
            of transcription-blocking DNA lesions and thus the present work
            does not support a role for TFIIS in TC-NER.
REFERENCE   3  (bases 1 to 2721)
  AUTHORS   Jensen,A. and Mullenders,L.H.
  TITLE     Transcription factor IIS impacts UV-inhibited transcription
  JOURNAL   DNA Repair (Amst.) 9 (11), 1142-1150 (2010)
   PUBMED   20729154
  REMARK    GeneRIF: a role for TFIIS in transcription recovery and
            re-establishment of the balance between hypo- and
            hyper-phosphorylated RNAPII after DNA damage repair
REFERENCE   4  (bases 1 to 2721)
  AUTHORS   Asp,J., Persson,F., Kost-Alimova,M. and Stenman,G.
  TITLE     CHCHD7-PLAG1 and TCEA1-PLAG1 gene fusions resulting from cryptic,
            intrachromosomal 8q rearrangements in pleomorphic salivary gland
            adenomas
  JOURNAL   Genes Chromosomes Cancer 45 (9), 820-828 (2006)
   PUBMED   16736500
  REMARK    GeneRIF: PLAG1 protein is overexpressed in epithelial,
            myoepithelial, and mesenchymal-like tumor cells in tumors with
            fusions to CHCHD7 and TCEA1.
REFERENCE   5  (bases 1 to 2721)
  AUTHORS   Ling,Y., Smith,A.J. and Morgan,G.T.
  TITLE     A sequence motif conserved in diverse nuclear proteins identifies a
            protein interaction domain utilised for nuclear targeting by human
            TFIIS
  JOURNAL   Nucleic Acids Res. 34 (8), 2219-2229 (2006)
   PUBMED   16648364
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 2721)
  AUTHORS   Qian,X., Jeon,C., Yoon,H., Agarwal,K. and Weiss,M.A.
  TITLE     Structure of a new nucleic-acid-binding motif in eukaryotic
            transcriptional elongation factor TFIIS
  JOURNAL   Nature 365 (6443), 277-279 (1993)
   PUBMED   7626141
  REMARK    Erratum:[Nature 1995 Jul 20;376(6537):279]
REFERENCE   7  (bases 1 to 2721)
  AUTHORS   Chen,H.C., England,L. and Kane,C.M.
  TITLE     Characterization of a HeLa cDNA clone encoding the human SII
            protein, an elongation factor for RNA polymerase II
  JOURNAL   Gene 116 (2), 253-258 (1992)
   PUBMED   1378807
REFERENCE   8  (bases 1 to 2721)
  AUTHORS   Kato,H., Sumimoto,H., Pognonec,P., Chen,C.H., Rosen,C.A. and
            Roeder,R.G.
  TITLE     HIV-1 Tat acts as a processivity factor in vitro in conjunction
            with cellular elongation factors
  JOURNAL   Genes Dev. 6 (4), 655-666 (1992)
   PUBMED   1559613
REFERENCE   9  (bases 1 to 2721)
  AUTHORS   Yoo,O.J., Yoon,H.S., Baek,K.H., Jeon,C.J., Miyamoto,K., Ueno,A. and
            Agarwal,K.
  TITLE     Cloning, expression and characterization of the human transcription
            elongation factor, TFIIS
  JOURNAL   Nucleic Acids Res. 19 (5), 1073-1079 (1991)
   PUBMED   1708494
REFERENCE   10 (bases 1 to 2721)
  AUTHORS   Reines,D., Chamberlin,M.J. and Kane,C.M.
  TITLE     Transcription elongation factor SII (TFIIS) enables RNA polymerase
            II to elongate through a block to transcription in a human gene in
            vitro
  JOURNAL   J. Biol. Chem. 264 (18), 10799-10809 (1989)
   PUBMED   2471707
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AU280634.1, AU125645.1, X57198.1, X62585.1, BX538034.1 and
            M81601.1.
            On or before Mar 4, 2006 this sequence version replaced
            gi:89028632, gi:89028634.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: X57198.1, AK297957.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-55                AU280634.1         1-55
            56-363              AU125645.1         1-308
            364-1356            X57198.1           166-1158
            1357-2590           X62585.1           1201-2434
            2591-2706           BX538034.1         2849-2964
            2707-2719           X62585.1           2550-2562
            2720-2721           M81601.1           2633-2634
FEATURES             Location/Qualifiers
     source          1..2721
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="8"
                     /map="8q11.2"
     gene            1..2721
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /note="transcription elongation factor A (SII), 1"
                     /db_xref="GeneID:6917"
                     /db_xref="HGNC:11612"
                     /db_xref="HPRD:03252"
                     /db_xref="MIM:601425"
     exon            1..386
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    24..26
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /note="upstream in-frame stop codon"
     CDS             324..1166
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /note="isoform 2 is encoded by transcript variant 2;
                     transcription elongation factor A protein 1; transcription
                     elongation factor TFIIS.o; transcription elongation factor
                     S-II protein 1"
                     /codon_start=1
                     /product="transcription elongation factor A protein 1
                     isoform 2"
                     /protein_id="NP_958845.1"
                     /db_xref="GI:45439355"
                     /db_xref="CCDS:CCDS47857.1"
                     /db_xref="GeneID:6917"
                     /db_xref="HGNC:11612"
                     /db_xref="HPRD:03252"
                     /db_xref="MIM:601425"
                     /translation="
MEDEVVRFAKKMDKMVQKKNASTRIGMSVNAIRKQSTDEEVTSLAKSLIKSWKKLLDGPSTEKDLDEKKKEPAITSQNSPEAREESTSSGNVSNRKDETNARDTYVSSFPRAPSTSDSVRLKCREMLAAALRTGDDYIAIGADEEELGSQIEEAIYQEIRNTDMKYKNRVRSRISNLKDAKNPNLRKNVLCGNIPPDLFARMTAEEMASDELKEMRKNLTKEAIREHQMAKTGGTQTDLFTCGKCKKKNCTYTQVQTRSADEPMTTFVVCNECGNRWKFC
"
     misc_feature    327..494
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /note="N-terminal domain (domain I) of transcription
                     elongation factor S-II (TFIIS); similar to a domain found
                     in elongin A and CRSP70; likely to be involved in
                     transcription; domain I from TFIIS interacts with RNA
                     polymerase II holoenzyme; Region: TFIIS_I; cd00183"
                     /db_xref="CDD:29145"
     misc_feature    333..1163
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /note="transcription elongation factor S-II; Region:
                     TFSII; TIGR01385"
                     /db_xref="CDD:213613"
     misc_feature    order(351..356,363..365,420..425)
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /note="putative RNA polymerase binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:29145"
     misc_feature    549..551
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    558..560
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    558..560
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    585..587
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    666..1010
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /note="Transcription factor S-II (TFIIS), central domain;
                     Region: TFIIS_M; pfam07500"
                     /db_xref="CDD:203654"
     misc_feature    1041..1157
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /note="Transcription factor S-II (TFIIS); Region: TFIIS_C;
                     pfam01096"
                     /db_xref="CDD:201594"
     exon            387..492
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /inference="alignment:Splign:1.39.8"
     exon            493..580
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /inference="alignment:Splign:1.39.8"
     exon            581..726
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /inference="alignment:Splign:1.39.8"
     exon            727..783
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /inference="alignment:Splign:1.39.8"
     exon            784..938
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /inference="alignment:Splign:1.39.8"
     exon            939..1085
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /inference="alignment:Splign:1.39.8"
     STS             999..1950
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /standard_name="D3S4495"
                     /db_xref="UniSTS:474550"
     exon            1086..1157
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /inference="alignment:Splign:1.39.8"
     exon            1158..2714
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /inference="alignment:Splign:1.39.8"
     STS             1230..1326
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /standard_name="D8S2054"
                     /db_xref="UniSTS:62475"
     variation       1362
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1050471"
     variation       1759
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11550741"
     variation       1794
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:11550739"
     STS             2442..2562
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /standard_name="RH66562"
                     /db_xref="UniSTS:91733"
     variation       2547
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1050523"
     polyA_signal    2687..2692
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
     polyA_site      2714
                     /gene="TCEA1"
                     /gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
ORIGIN      
agccggaagccacgcctgcccactagcccgacgcccgcctggcgggaacatgggctcgcccctcaccagcgatctgcagtcagttggtagcgcctgcacgtcgcgcgcggtgttcgattgtcgctgcctggggaggaggagccggagccgccgccgccgccgccgccgccgcgggcttcgttcgtaaggaagggggcctaggcccgggcctgcggtggtgggggttgctgcgcgccgggggtcgctcctgctgtgtcttccgctccagcttcgcccacttccccttgccagcggggtgggcgcggagaagacctgccggagccatggaggacgaagtggtccgctttgccaagaagatggacaagatggtgcagaagaagaacgcgtccacaagaatcggaatgtcagttaatgctattcgcaagcagagtacagatgaggaagttacatctttggcaaagtctctcatcaaatcctggaaaaaattattagatgggccatcaactgagaaagaccttgacgaaaagaagaaagaacctgcaattacatcgcagaacagccctgaggcaagagaagaaagtacttccagcggcaatgtaagcaacagaaaggatgagacaaatgctcgagatacttatgtttcatcctttcctcgggcaccaagcacttctgattctgtgcggttgaagtgtagggagatgcttgctgcagctcttcgaacaggggatgactacattgcaattggagctgatgaggaagaattaggatctcaaattgaagaagctatatatcaagaaataaggaatacagacatgaaatacaaaaatagagtacgaagtaggatatcaaatcttaaagatgcaaaaaatccaaatttaaggaaaaatgtcctctgtgggaatattcctcctgacttatttgctagaatgacagcagaggaaatggctagtgatgagctgaaagagatgcggaaaaacttgaccaaagaagccatcagagagcatcagatggccaagactggtgggacccagactgacttgttcacatgtggcaaatgtaaaaagaagaattgcacttacacacaggtacaaacccgtagtgctgatgaaccaatgacaacatttgttgtctgtaatgaatgtggaaatcgatggaagttctgttgagttggaagaattggcaaaatatctggaccattaagaaaacggattttgtaactagctttaaactaggccaagcaactagttttcctgcaaatcaaatttttaaagcaacttgggttagactttgtttttgacctaacatcccttccttaaatgccttctgtagtttcagatcagtagggagaccatataataattttatggtacctgtttcaaaacatattttttctgtttttataagtaagttgatattaattaaactcttggcaatatttcttctttcttaaaggaaaatataccttaactttttttcttttacactgtgaaacatacacagtagaaattctgttactctctgttattaatacataaatgaaaatacatttttttccatattggcatgtagctacaaatattaaaggaggagaaaaggtaatataattttaggtttaccaaatatggtgtgtattcaaataatacttgaccagcttatctaaaatgtacataattttgaggtagcttatgaatttgattttaattattatgttcacaagcttggaatattagatattattttgcatctgtaactaaccgtgatcatcatttcttgtaatttcttgtacatgtatattacttgttcttaatagatttttggaaacaagactttattgagatcagtttggttttcctgttaatttacctgtttgactttataatgtgttttagttttgcagaagaacactgttgtagtttagaaggcttttcataaatcccctcataggcaaagatgaaaacttcccactatttttttcccctcttaggaagacatactggaaagaaaatgtttagcatcttagtgtagtatagctattgtaaacagttcatgactagattttgattcggaaatctatactgaccaaggattaatcttaaggattgtataattcattaaagctgtggtctttccatgtggagactgatagaaaataattttgtcccaagtcttatttgctgactttttctgtcatgagtgagattgttgaacaaactgaatatatgggctatagcaagtagctttacagtacagatcttacaattaagttttgcttttgttaaagtgtgtaccattttttctgtttggagtaagacaaaaattgttttgacataggttccctagggtacacttgctctagcatactttaaaggccactgttgcaaagtctacattttatgctgaatctgcattctgtcaggcacccgtagaaagacctcagtacatgctttgcactctcctttgctccctttttccaatttcttattgcatatcattttgttgtaatacagaaagcagcatttttaaatgtccgtgttaagaattggcccactggtaccaactcacctctattttgtcagttcatagttgaagattttgttttatttcaaaaacaaagtacatttttgaaataatgtttcagaataaaataatctcacttttaagtgatccattttaaaatttgtaattcaataaagttttttttgttgttaaacataaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:6917 -> Molecular function: GO:0003677 [DNA binding] evidence: IEA
            GeneID:6917 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:6917 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IEA
            GeneID:6917 -> Biological process: GO:0006281 [DNA repair] evidence: TAS
            GeneID:6917 -> Biological process: GO:0006283 [transcription-coupled nucleotide-excision repair] evidence: TAS
            GeneID:6917 -> Biological process: GO:0006289 [nucleotide-excision repair] evidence: TAS
            GeneID:6917 -> Biological process: GO:0006366 [transcription from RNA polymerase II promoter] evidence: TAS
            GeneID:6917 -> Biological process: GO:0006368 [transcription elongation from RNA polymerase II promoter] evidence: TAS
            GeneID:6917 -> Biological process: GO:0010467 [gene expression] evidence: TAS
            GeneID:6917 -> Biological process: GO:0016032 [viral process] evidence: TAS
            GeneID:6917 -> Biological process: GO:0030218 [erythrocyte differentiation] evidence: IEA
            GeneID:6917 -> Biological process: GO:0032784 [regulation of DNA-dependent transcription, elongation] evidence: IEA
            GeneID:6917 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IEA
            GeneID:6917 -> Biological process: GO:0050434 [positive regulation of viral transcription] evidence: TAS
            GeneID:6917 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:6917 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
            GeneID:6917 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.