2025-06-14 20:49:38, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_181876 4092 bp mRNA linear PRI 17-APR-2013 DEFINITION Homo sapiens protein phosphatase 2, regulatory subunit B, gamma (PPP2R2C), transcript variant 2, mRNA. ACCESSION NM_181876 VERSION NM_181876.2 GI:109255253 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 4092) AUTHORS Jacob,C., Nguyen,T.T., Weissflog,L., Herrmann,M., Liedel,S., Zamzow,K., Jans,T., Renner,T., Reichert,S., Gross-Lesch,S., Lesch,K.P. and Reif,A. TITLE PPP2R2C as a candidate gene of a temperament and character trait-based endophenotype of ADHD JOURNAL Atten Defic Hyperact Disord 4 (3), 145-152 (2012) PUBMED 22664926 REMARK GeneRIF: evidence suggests that allelic variation in PPP2R2C may be associated with a variety of personality traits and ADHD per se. REFERENCE 2 (bases 1 to 4092) AUTHORS Kim,S. and Webster,M.J. TITLE Integrative genome-wide association analysis of cytoarchitectural abnormalities in the prefrontal cortex of psychiatric disorders JOURNAL Mol. Psychiatry 16 (4), 452-461 (2011) PUBMED 20308991 REMARK GeneRIF: Observational study and genome-wide association study of gene-disease association. (HuGE Navigator) REFERENCE 3 (bases 1 to 4092) AUTHORS Backx,L., Vermeesch,J., Pijkels,E., de Ravel,T., Seuntjens,E. and Van Esch,H. TITLE PPP2R2C, a gene disrupted in autosomal dominant intellectual disability JOURNAL Eur J Med Genet 53 (5), 239-243 (2010) PUBMED 20601260 REMARK GeneRIF: encoding a subunit of proteinphosphatase 2A with a unique expression pattern in brain and a role in synaptic plasticity REFERENCE 4 (bases 1 to 4092) AUTHORS Rung,J., Cauchi,S., Albrechtsen,A., Shen,L., Rocheleau,G., Cavalcanti-Proenca,C., Bacot,F., Balkau,B., Belisle,A., Borch-Johnsen,K., Charpentier,G., Dina,C., Durand,E., Elliott,P., Hadjadj,S., Jarvelin,M.R., Laitinen,J., Lauritzen,T., Marre,M., Mazur,A., Meyre,D., Montpetit,A., Pisinger,C., Posner,B., Poulsen,P., Pouta,A., Prentki,M., Ribel-Madsen,R., Ruokonen,A., Sandbaek,A., Serre,D., Tichet,J., Vaxillaire,M., Wojtaszewski,J.F., Vaag,A., Hansen,T., Polychronakos,C., Pedersen,O., Froguel,P. and Sladek,R. TITLE Genetic variant near IRS1 is associated with type 2 diabetes, insulin resistance and hyperinsulinemia JOURNAL Nat. Genet. 41 (10), 1110-1115 (2009) PUBMED 19734900 REMARK GeneRIF: Observational study and genome-wide association study of gene-disease association. (HuGE Navigator) Erratum:[Nat Genet. 2009 Oct;41(10):1156] REFERENCE 5 (bases 1 to 4092) AUTHORS Eichhorn,P.J., Creyghton,M.P., Wilhelmsen,K., van Dam,H. and Bernards,R. TITLE A RNA interference screen identifies the protein phosphatase 2A subunit PR55gamma as a stress-sensitive inhibitor of c-SRC JOURNAL PLoS Genet. 3 (12), E218 (2007) PUBMED 18069897 REMARK GeneRIF: novel mechanism of c-SRC regulation whereby in response to stress c-SRC activity is regulated, at least in part, through loss of the interaction with its inhibitor, PR55gamma REFERENCE 6 (bases 1 to 4092) AUTHORS Hu,P., Yu,L., Zhang,M., Zheng,L., Zhao,Y., Fu,Q. and Zhao,S. TITLE Molecular cloning and mapping of the brain-abundant B1gamma subunit of protein phosphatase 2A, PPP2R2C, to human chromosome 4p16 JOURNAL Genomics 67 (1), 83-86 (2000) PUBMED 10945473 REFERENCE 7 (bases 1 to 4092) AUTHORS Torres,R., Ide,S.E., Dehejia,A., Baras,A. and Polymeropoulos,M.H. TITLE Genomic structure and localization of the human protein phosphatase 2A BRgamma regulatory subunit JOURNAL DNA Res. 6 (5), 323-327 (1999) PUBMED 10574460 REFERENCE 8 (bases 1 to 4092) AUTHORS Strack,S., Zaucha,J.A., Ebner,F.F., Colbran,R.J. and Wadzinski,B.E. TITLE Brain protein phosphatase 2A: developmental regulation and distinct cellular and subcellular localization by B subunits JOURNAL J. Comp. Neurol. 392 (4), 515-527 (1998) PUBMED 9514514 REFERENCE 9 (bases 1 to 4092) AUTHORS Ruediger,R., Brewis,N., Ohst,K. and Walter,G. TITLE Increasing the ratio of PP2A core enzyme to holoenzyme inhibits Tat-stimulated HIV-1 transcription and virus production JOURNAL Virology 238 (2), 432-443 (1997) PUBMED 9400615 REFERENCE 10 (bases 1 to 4092) AUTHORS Tung,H.Y., De Rocquigny,H., Zhao,L.J., Cayla,X., Roques,B.P. and Ozon,R. TITLE Direct activation of protein phosphatase-2A0 by HIV-1 encoded protein complex NCp7:vpr JOURNAL FEBS Lett. 401 (2-3), 197-201 (1997) PUBMED 9013886 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AK093115.1 and AC116317.4. On Jun 19, 2006 this sequence version replaced gi:32967592. Summary: The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a gamma isoform of the regulatory subunit B55 subfamily. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (2) encodes the longest isoform (b). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK093115.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025085 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1620 AK093115.1 1-1620 1621-4092 AC116317.4 82065-84536 c FEATURES Location/Qualifiers source 1..4092 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="4" /map="4p16.1" gene 1..4092 /gene="PPP2R2C" /gene_synonym="B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G" /note="protein phosphatase 2, regulatory subunit B, gamma" /db_xref="GeneID:5522" /db_xref="HGNC:9306" /db_xref="MIM:605997" exon 1..94 /gene="PPP2R2C" /gene_synonym="B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G" /inference="alignment:Splign:1.39.8" CDS 25..1368 /gene="PPP2R2C" /gene_synonym="B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G" /EC_number="3.1.3.16" /note="isoform b is encoded by transcript variant 2; protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform; PP2A, subunit B, B-gamma isoform; PP2A, subunit B, B55-gamma isoform; PP2A, subunit B, PR55-gamma isoform; PP2A, subunit B, R2-gamma isoform; protein phosphatase 2A1 B gamma subunit; phosphoprotein phosphatase 2A BR gamma regulatory chain; gamma isoform of regulatory subunit B55, protein phosphatase 2; serine/threonine-protein phosphatase 2A 55 kDa regulatory subunit B gamma isoform" /codon_start=1 /product="protein phosphatase 2, regulatory subunit B, gamma isoform b" /protein_id="NP_870991.1" /db_xref="GI:32967593" /db_xref="CCDS:CCDS3388.1" /db_xref="GeneID:5522" /db_xref="HGNC:9306" /db_xref="MIM:605997" /translation="
MGLSFFSKHLPIQEGQPWALKTPADIISTVEFNHTGELLATGDKGGRVVIFQREPESKNAPHSQGEYDVYSTFQSHEPEFDYLKSLEIEEKINKIKWLPQQNAAHSLLSTNDKTIKLWKITERDKRPEGYNLKDEEGKLKDLSTVTSLQVPVLKPMDLMVEVSPRRIFANGHTYHINSISVNSDCETYMSADDLRINLWHLAITDRSFNIVDIKPANMEDLTEVITASEFHPHHCNLFVYSSSKGSLRLCDMRAAALCDKHSKLFEEPEDPSNRSFFSEIISSVSDVKFSHSGRYMLTRDYLTVKVWDLNMEARPIETYQVHDYLRSKLCSLYENDCIFDKFECAWNGSDSVIMTGAYNNFFRMFDRNTKRDVTLEASRESSKPRAVLKPRRVCVGGKRRRDDISVDSLDFTKKILHTAWHPAENIIAIAATNNLYIFQDKVNSDMH
" misc_feature 82..1122 /gene="PPP2R2C" /gene_synonym="B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G" /note="WD40 domain, found in a number of eukaryotic proteins that cover a wide variety of functions including adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly; typically contains a GH dipeptide 11-24 residues from...; Region: WD40; cl02567" /db_xref="CDD:207648" misc_feature 88..1338 /gene="PPP2R2C" /gene_synonym="B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G" /note="Serine/threonine protein phosphatase 2A, regulatory subunit [Signal transduction mechanisms]; Region: CDC55; COG5170" /db_xref="CDD:34770" misc_feature order(91..93,145..147,157..159,175..180,247..252,349..351, 358..360,376..381,424..429,478..480,493..495,538..540, 589..591,601..603,619..624,682..687,739..741,754..756, 772..777,823..828,913..915,943..948,985..990,1087..1089, 1099..1101,1117..1122) /gene="PPP2R2C" /gene_synonym="B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G" /note="structural tetrad; other site" /db_xref="CDD:29257" exon 95..192 /gene="PPP2R2C" /gene_synonym="B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G" /inference="alignment:Splign:1.39.8" exon 193..358 /gene="PPP2R2C" /gene_synonym="B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G" /inference="alignment:Splign:1.39.8" STS 226..321 /gene="PPP2R2C" /gene_synonym="B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G" /standard_name="D4S815E" /db_xref="UniSTS:473011" exon 359..471 /gene="PPP2R2C" /gene_synonym="B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G" /inference="alignment:Splign:1.39.8" variation 462 /gene="PPP2R2C" /gene_synonym="B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G" /replace="a" /replace="g" /db_xref="dbSNP:35368770" exon 472..649 /gene="PPP2R2C" /gene_synonym="B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G" /inference="alignment:Splign:1.39.8" variation 636 /gene="PPP2R2C" /gene_synonym="B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G" /replace="c" /replace="t" /db_xref="dbSNP:35410672" exon 650..814 /gene="PPP2R2C" /gene_synonym="B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G" /inference="alignment:Splign:1.39.8" exon 815..984 /gene="PPP2R2C" /gene_synonym="B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G" /inference="alignment:Splign:1.39.8" exon 985..1076 /gene="PPP2R2C" /gene_synonym="B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G" /inference="alignment:Splign:1.39.8" exon 1077..4092 /gene="PPP2R2C" /gene_synonym="B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G" /inference="alignment:Splign:1.39.8" variation 1317 /gene="PPP2R2C" /gene_synonym="B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G" /replace="a" /replace="c" /db_xref="dbSNP:11545013" variation 2134 /gene="PPP2R2C" /gene_synonym="B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G" /replace="a" /replace="g" /db_xref="dbSNP:11554992" STS 2170..2334 /gene="PPP2R2C" /gene_synonym="B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G" /standard_name="SHGC-8649" /db_xref="UniSTS:32922" variation 2354 /gene="PPP2R2C" /gene_synonym="B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G" /replace="a" /replace="c" /db_xref="dbSNP:11554991" STS 3285..3416 /gene="PPP2R2C" /gene_synonym="B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G" /standard_name="RH94038" /db_xref="UniSTS:89600" STS 3935..4074 /gene="PPP2R2C" /gene_synonym="B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G" /standard_name="SHGC-59174" /db_xref="UniSTS:80504" polyA_signal 4062..4067 /gene="PPP2R2C" /gene_synonym="B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G" polyA_site 4092 /gene="PPP2R2C" /gene_synonym="B55-GAMMA; IMYPNO; IMYPNO1; PR52; PR55G" ORIGIN
acatgcaaaaagtggggcctggagatggggctgtcttttttctccaaacacttgcccatccaggaaggccagccctgggcattgaagactccagctgacatcatctctaccgttgagttcaaccacacgggagagctgctggccacaggtgacaagggcggccgggtcgtcatcttccagcgggaaccagagagtaaaaatgcgccccacagccagggcgaatacgacgtgtacagcactttccagagccacgagccggagtttgactatctcaagagcctggagatagaggagaagatcaacaagatcaagtggctcccacagcagaacgccgcccactcactcctgtccaccaacgataaaactatcaaattatggaagattaccgaacgagataaaaggcccgaaggatacaacctgaaggatgaagaggggaaacttaaggacctgtccacggtgacgtcactgcaggtgccagtgctgaagcccatggatctgatggtggaggtgagccctcggaggatctttgccaatggccacacctaccacatcaactccatctccgtcaacagtgactgcgagacctacatgtcggcggatgacctgcgcatcaacctctggcacctggccatcaccgacaggagcttcaacatcgtggacatcaagccggccaacatggaggaccttacggaggtgatcacagcatctgagttccatccgcaccactgcaacctcttcgtctacagcagcagcaagggctccctgcggctctgcgacatgcgggcagctgccctgtgtgacaagcattccaagctctttgaagagcctgaggaccccagtaaccgctcattcttctcggaaatcatctcctccgtgtccgacgtgaagttcagccacagcggccgctacatgctcacccgggactaccttacagtcaaggtctgggacctgaacatggaggcaagacccatagagacctaccaggtccatgactaccttcggagcaagctctgttccctgtacgagaacgactgcattttcgacaagtttgaatgtgcctggaacgggagcgacagcgtcatcatgaccggggcctacaacaacttcttccgcatgttcgatcggaacaccaagcgggacgtgaccctggaggcctcgagggaaagcagcaagccccgggctgtgctcaagccacggcgcgtgtgcgtggggggcaagcgccggcgtgatgacatcagtgtggacagcttggacttcaccaagaagatcctgcacacggcctggcacccggctgagaacatcattgccatcgccgccaccaacaacctgtacatcttccaggacaaggtaaactctgacatgcactaggtatgtgcagttcccggcccctgccacccagcctcatgcaagtcatccccgacatgaccttcacgaccgcaatgcaaggaggggaagaaagtcacagcactgatgaggacagctgcagaggtggcagtgtgtggacacaggaagtttgggccccctccctgccccagctttcctaggccagaattgtgtttggcagtaattgtctgtttaaaaaaataaaaaggaaaggaagcgttcaccgccacaaatcataaaatggacatgactgtggagtcttacagttcagggttctttcattcacgtcccttcctgtctcggtctgcggtctttaccacatcaataggactttttatgcgtccgggttaatttttcactccagtgcgtcctgttgcagggaccggagctgatgggagctgcttctcccccatgcctcactggtcccagatcagggctccagggacagatgatgagtctcaaacgagccagccaggggttcttttggttataaatggggcaattcgccctgtctcagagctgatgacctcaccgttgttttttggatggtgaattcatgctgagaatttgcagatgcaagctcctctcctaggtcttctgaatgtcttgaaacatcccaggtcccaggtctggtgcggtttcccgagaggagcggagtggggtttgtcttctgtgtgcctgtgtcctcatctgattcacctgccatttgctgagcctctgctgtgtaccaggcgtggtgctcagccctagaggcagttgacttaccctctgcagccctccctgccgcctcacccttcagcattcactgggcaccttcccggagcggacactgactcccatgcacgattttttggaatcttcctcctgactgtgaggtgggtgttcattcatttcctccataaacaccaacttctcgaagcgtgccaggctctgggctggatgctggggataagcgggaacccttaggatcccctctgtccacgagaagaagctgaggctctgagcggatgcacaggtcacccatggcaggtgccgtgcagtggtgtcaggaacccgtccgggtcttcacacaaggttctctccagtccatctcgtgggcggctcatgttagagcgacattcaaatggaaggtttggaaaggaatgcctctgtcttgtgaagtaggacatggcagacttggcgacgacaagggtccaggagaactgagacgcaggatggaagacagagaagaccccccggagctcctcgctctgcttggtggcttcaggagtgtggccctccccaggactccacttcatcctgggcttgcaccctccttgagccaatgcactgaactgcctttgaaaggaaattgcatgttctgaccattttaggatacctttactttaaggaccacacagtcccagaggacacatccctcgggaactctgcccctctgacaatgagggccacagagaaggtggtgtttccatggtagatgctcctgttctggtgataccaaacctgcccacccctctgagtcgtctttgctcatggacttgcagcagagccacgtagtttggcattttgattcagaaagtggggagcagagacccagccaaatccaaactttttttttggttttgttttgttttgttttttacaagatataacataacccaggaaacagacccagctgaggttattctcagtggattacagtatacttttgtgtgtgtaaaagcacaaagtgcatgtgtactcacttctggccatataacatttacacagggaaatggatcattgatttttttttaatcaacgtgaatgaagaatgtttgtttatatatcactataaaatccagttgacctggacagtattatatgtacatatctattctaattaaatttaacaatcaaaggattggattacttttttcccccttgtaaagaggttcgagaatgtggtcaattgtatagatagcgtgttaaagccaaaacccagctctgagggccttacccattacttggatatttgctacgatccatctccctttgtgagtcaaatgttaagagaagaaacttgtatttgcagctagaggttactgtcacatcatagatttaacatttaccatcttcaaagtacaaatcttacatgtccttcaaaaggaggtcttaatacagttcctagttccttacttctgttttaaactttgggtaccaaaccaaaaagaagaaaaaagaaaggaaaagatcttctttgaagaaaagtatgtctctggatccctggaaaataatgatgtccaaagcaaattgtgaagatcaaatgtgtgttaagaaaaggtgtcgaggggagggacaaaaccagaaacggtggaaggaccagtgtaatagtcacagacttgcatcctggctctgcttacatttcctggtactctcgaatgtacgggcgttcacatagtcattgtgaagttgttggggtttttttggttttgtttttaatttagctcttctctgaggacgaagctgttggtggtggtggtggtgggggtggtggtgtgggatacatggtggtcaagttgtcagccctgatcagtttggactctgtaactcataggtgcattctttttttctttggtgtctcacaaattacccaattgttgaataaaactataaatatgttaataccagctttttccaataaaataacaaatgttacatcaaaaacga
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:5522 -> Molecular function: GO:0008601 [protein phosphatase type 2A regulator activity] evidence: NAS GeneID:5522 -> Biological process: GO:0007165 [signal transduction] evidence: NAS GeneID:5522 -> Cellular component: GO:0000159 [protein phosphatase type 2A complex] evidence: NAS ANNOTATIONS from NCBI Entrez Gene (20130726): NP_870991 -> EC 3.1.3.16
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.