Home |
Help |
Advanced search
2025-05-09 20:01:01, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_139131 3908 bp mRNA linear PRI 07-JUL-2013
DEFINITION Homo sapiens nucleoporin 98kDa (NUP98), transcript variant 2, mRNA.
ACCESSION NM_139131
VERSION NM_139131.3 GI:296040485
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3908)
AUTHORS Di Nunzio,F., Fricke,T., Miccio,A., Valle-Casuso,J.C., Perez,P.,
Souque,P., Rizzi,E., Severgnini,M., Mavilio,F., Charneau,P. and
Diaz-Griffero,F.
TITLE Nup153 and Nup98 bind the HIV-1 core and contribute to the early
steps of HIV-1 replication
JOURNAL Virology 440 (1), 8-18 (2013)
PUBMED 23523133
REMARK GeneRIF: The roles of NUP153 and nup98 in the integration and
replication of HIV-1 in human Jurkat lymphocytes are reported.
REFERENCE 2 (bases 1 to 3908)
AUTHORS Funasaka,T., Balan,V., Raz,A. and Wong,R.W.
TITLE Nucleoporin Nup98 mediates galectin-3 nuclear-cytoplasmic
trafficking
JOURNAL Biochem. Biophys. Res. Commun. 434 (1), 155-161 (2013)
PUBMED 23541576
REMARK GeneRIF: Nup98 RNA interference significantly suppresses downstream
mRNA expression in the ss-catenin pathway, while nuclear galectin-3
binds to ss-catenin to inhibit transcriptional activity.
REFERENCE 3 (bases 1 to 3908)
AUTHORS Liang,Y., Franks,T.M., Marchetto,M.C., Gage,F.H. and Hetzer,M.W.
TITLE Dynamic association of NUP98 with the human genome
JOURNAL PLoS Genet. 9 (2), E1003308 (2013)
PUBMED 23468646
REMARK GeneRIF: This work demonstrates for the first time that NUP98
dynamically associates with the human genome during
differentiation, revealing a role of a nuclear pore protein in
regulating developmental gene expression programs.
REFERENCE 4 (bases 1 to 3908)
AUTHORS Singer,S., Zhao,R., Barsotti,A.M., Ouwehand,A., Fazollahi,M.,
Coutavas,E., Breuhahn,K., Neumann,O., Longerich,T., Pusterla,T.,
Powers,M.A., Giles,K.M., Leedman,P.J., Hess,J., Grunwald,D.,
Bussemaker,H.J., Singer,R.H., Schirmacher,P. and Prives,C.
TITLE Nuclear pore component Nup98 is a potential tumor suppressor and
regulates posttranscriptional expression of select p53 target genes
JOURNAL Mol. Cell 48 (5), 799-810 (2012)
PUBMED 23102701
REMARK GeneRIF: Nup98 functions as a potential tumor suppressor and
regulates posttranscriptional expression of select p53 target
genes.
REFERENCE 5 (bases 1 to 3908)
AUTHORS Rajani,K.R., Pettit Kneller,E.L., McKenzie,M.O., Horita,D.A.,
Chou,J.W. and Lyles,D.S.
TITLE Complexes of vesicular stomatitis virus matrix protein with host
Rae1 and Nup98 involved in inhibition of host transcription
JOURNAL PLoS Pathog. 8 (9), E1002929 (2012)
PUBMED 23028327
REMARK GeneRIF: vesicular stomatitis virus M protein interacted
efficiently with Rae1-Nup98 complexes associated with the chromatin
fraction of host nuclei, consistent with an effect on host
transcription
REFERENCE 6 (bases 1 to 3908)
AUTHORS Stutz,F., Izaurralde,E., Mattaj,I.W. and Rosbash,M.
TITLE A role for nucleoporin FG repeat domains in export of human
immunodeficiency virus type 1 Rev protein and RNA from the nucleus
JOURNAL Mol. Cell. Biol. 16 (12), 7144-7150 (1996)
PUBMED 8943370
REFERENCE 7 (bases 1 to 3908)
AUTHORS Hu,T., Guan,T. and Gerace,L.
TITLE Molecular and functional characterization of the p62 complex, an
assembly of nuclear pore complex glycoproteins
JOURNAL J. Cell Biol. 134 (3), 589-601 (1996)
PUBMED 8707840
REFERENCE 8 (bases 1 to 3908)
AUTHORS Borrow,J., Shearman,A.M., Stanton,V.P. Jr., Becher,R., Collins,T.,
Williams,A.J., Dube,I., Katz,F., Kwong,Y.L., Morris,C.,
Ohyashiki,K., Toyama,K., Rowley,J. and Housman,D.E.
TITLE The t(7;11)(p15;p15) translocation in acute myeloid leukaemia fuses
the genes for nucleoporin NUP98 and class I homeoprotein HOXA9
JOURNAL Nat. Genet. 12 (2), 159-167 (1996)
PUBMED 8563754
REFERENCE 9 (bases 1 to 3908)
AUTHORS Nakamura,T., Largaespada,D.A., Lee,M.P., Johnson,L.A.,
Ohyashiki,K., Toyama,K., Chen,S.J., Willman,C.L., Chen,I.M.,
Feinberg,A.P., Jenkins,N.A., Copeland,N.G. and Shaughnessy,J.D. Jr.
TITLE Fusion of the nucleoporin gene NUP98 to HOXA9 by the chromosome
translocation t(7;11)(p15;p15) in human myeloid leukaemia
JOURNAL Nat. Genet. 12 (2), 154-158 (1996)
PUBMED 8563753
REFERENCE 10 (bases 1 to 3908)
AUTHORS Radu,A., Moore,M.S. and Blobel,G.
TITLE The peptide repeat domain of nucleoporin Nup98 functions as a
docking site in transport across the nuclear pore complex
JOURNAL Cell 81 (2), 215-222 (1995)
PUBMED 7736573
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DB084013.1, U41815.1 and
BC041136.1.
On May 14, 2010 this sequence version replaced gi:56549641.
Summary: Signal-mediated nuclear import and export proceed through
the nuclear pore complex (NPC), which is comprised of approximately
50 unique proteins collectively known as nucleoporins. The 98 kDa
nucleoporin is generated through a biogenesis pathway that involves
synthesis and proteolytic cleavage of a 186 kDa precursor protein.
This cleavage results in the 98 kDa nucleoporin as well as a 96 kDa
nucleoporin, both of which are localized to the nucleoplasmic side
of the NPC. Rat studies show that the 98 kDa nucleoporin functions
as one of several docking site nucleoporins of transport
substrates. The human gene has been shown to fuse to several genes
following chromosome translocations in acute myelogenous leukemia
(AML) and T-cell acute lymphocytic leukemia (T-ALL). This gene is
one of several genes located in the imprinted gene domain of
11p15.5, an important tumor-suppressor gene region. Alterations in
this region have been associated with the Beckwith-Wiedemann
syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma,
and lung, ovarian, and breast cancer. Alternative splicing of this
gene results in several transcript variants; however, not all
variants have been fully described. [provided by RefSeq, May 2010].
Transcript Variant: This variant (2) lacks multiple 3' exons but
has an alternate 3' sequence including the coding region and UTR,
as compared to variant 1. The encoded isoform 2 has a distinct and
shorter C-terminus, as compared to isoform 1.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: U41815.1, BC041136.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-277 DB084013.1 1-277
278-3404 U41815.1 1-3127
3405-3891 BC041136.1 3154-3640
3892-3908 U41815.1 3614-3630
FEATURES Location/Qualifiers
source 1..3908
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="11"
/map="11p15.5"
gene 1..3908
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/note="nucleoporin 98kDa"
/db_xref="GeneID:4928"
/db_xref="HGNC:8068"
/db_xref="HPRD:03012"
/db_xref="MIM:601021"
exon 1..393
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/inference="alignment:Splign:1.39.8"
variation complement(59)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:180810726"
variation complement(146)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="g"
/db_xref="dbSNP:188372818"
variation complement(192)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:59527098"
variation complement(270)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:60063096"
variation complement(278)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:367949661"
variation complement(310..311)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace=""
/replace="gt"
/db_xref="dbSNP:144528677"
misc_feature 365..367
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/note="upstream in-frame stop codon"
exon 394..497
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/inference="alignment:Splign:1.39.8"
variation complement(412)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="c"
/db_xref="dbSNP:72844304"
CDS 422..3184
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/note="isoform 2 is encoded by transcript variant 2;
GLFG-repeat containing nucleoporin; Nup98-Nup96; nuclear
pore complex protein Nup98-Nup96"
/codon_start=1
/product="nuclear pore complex protein Nup98-Nup96 isoform
2"
/protein_id="NP_624357.1"
/db_xref="GI:21264369"
/db_xref="CCDS:CCDS41606.1"
/db_xref="GeneID:4928"
/db_xref="HGNC:8068"
/db_xref="HPRD:03012"
/db_xref="MIM:601021"
/translation="
MFNKSFGTPFGGGTGGFGTTSTFGQNTGFGTTSGGAFGTSAFGSSNNTGGLFGNSQTKPGGLFGTSSFSQPATSTSTGFGFGTSTGTANTLFGTASTGTSLFSSQNNAFAQNKPTGFGNFGTSTSSGGLFGTTNTTSNPFGSTSGSLFGPSSFTAAPTGTTIKFNPPTGTDTMVKAGVSTNISTKHQCITAMKEYESKSLEELRLEDYQANRKGPQNQVGAGTTTGLFGSSPATSSATGLFSSSTTNSGFAYGQNKTAFGTSTTGFGTNPGGLFGQQNQQTTSLFSKPFGQATTTQNTGFSFGNTSTIGQPSTNTMGLFGVTQASQPGGLFGTATNTSTGTAFGTGTGLFGQTNTGFGAVGSTLFGNNKLTTFGSSTTSAPSFGTTSGGLFGFGTNTSGNSIFGSKPAPGTLGTGLGAGFGTALGAGQASLFGNNQPKIGGPLGTGAFGAPGFNTTTATLGFGAPQAPVALTDPNASAAQQAVLQQHINSLTYSPFGDSPLFRNPMSDPKKKEERLKPTNPAAQKALTTPTHYKLTPRPATRVRPKALQTTGTAKSHLFDGLDDDEPSLANGAFMPKKSIKKLVLKNLNNSNLFSPVNRDSENLASPSEYPENGERFSFLSKPVDENHQQDGDEDSLVSHFYTNPIAKPIPQTPESAGNKHSNSNSVDDTIVALNMRAALRNGLEGSSEETSFHDESLQDDREEIENNSYHMHPAGIILTKVGYYTIPSMDDLAKITNEKGECIVSDFTIGRKGYGSIYFEGDVNLTNLNLDDIVHIRRKEVVVYLDDNQKPPVGEGLNRKAEVTLDGVWPTDKTSRCLIKSPDRLADINYEGRLEAVSRKQGAQFKEYRPETGSWVFKVSHFSKYGLQDSDEEEEEHPSKTSTKKLKTAPLPPASQTTPLQMALNGKPAPPPQVEKKGQ
"
misc_feature 2192..2194
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 2204..2206
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 2237..2239
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 2237..2239
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 2411..2413
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 2588..3010
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/note="Nucleoporin autopeptidase; Region: Nucleoporin2;
pfam04096"
/db_xref="CDD:202886"
misc_feature 2885..2887
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 3008..3010
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/experiment="experimental evidence, no additional details
recorded"
/note="proteolytic cleavage site; modified site"
/db_xref="HPRD:03012"
misc_feature 3032..3034
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 3032..3034
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
variation complement(459)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="g"
/db_xref="dbSNP:375758302"
variation complement(496)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:201643505"
exon 498..599
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/inference="alignment:Splign:1.39.8"
variation complement(513)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:371864624"
variation complement(514)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:377383450"
variation complement(583)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:147797843"
variation complement(584)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:201001086"
exon 600..776
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/inference="alignment:Splign:1.39.8"
variation complement(628)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:371498196"
variation complement(638)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:368818596"
variation complement(654)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="g"
/replace="t"
/db_xref="dbSNP:374160172"
variation complement(674)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:79912970"
variation complement(682)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:201999358"
variation complement(691)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:148608250"
variation complement(764)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:200536174"
variation complement(769)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="c"
/db_xref="dbSNP:61756125"
exon 777..916
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/inference="alignment:Splign:1.39.8"
variation complement(785)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:376676025"
variation complement(799)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:149542589"
variation complement(893)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="t"
/db_xref="dbSNP:199563619"
variation complement(916)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:34160712"
exon 917..1024
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/inference="alignment:Splign:1.39.8"
variation complement(923)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:150774282"
variation complement(924)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="c"
/db_xref="dbSNP:141741442"
variation complement(1010)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:138890550"
exon 1025..1205
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/inference="alignment:Splign:1.39.8"
variation complement(1086)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:200555087"
variation complement(1102)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:145045544"
variation complement(1112)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:142828548"
variation complement(1114)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:202133026"
variation complement(1130)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:148092095"
variation complement(1204)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:143629914"
exon 1206..1369
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/inference="alignment:Splign:1.39.8"
variation complement(1207)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:373808051"
variation complement(1215)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="g"
/replace="t"
/db_xref="dbSNP:370439005"
variation complement(1223)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:149008676"
variation complement(1273)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="g"
/db_xref="dbSNP:145859584"
variation complement(1288)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:201623628"
variation complement(1298)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:61732810"
variation complement(1306)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="g"
/db_xref="dbSNP:146870554"
variation complement(1313)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:142518872"
variation complement(1336)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="g"
/db_xref="dbSNP:376607536"
variation complement(1365)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="c"
/db_xref="dbSNP:375025381"
exon 1370..1507
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/inference="alignment:Splign:1.39.8"
variation complement(1374)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:17854092"
variation complement(1424)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:373436118"
variation complement(1426)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:375278329"
variation complement(1484)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:112768729"
variation complement(1506)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:201706881"
exon 1508..1595
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/inference="alignment:Splign:1.39.8"
variation complement(1547)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:17854091"
variation complement(1554)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="g"
/db_xref="dbSNP:144324099"
variation complement(1577)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:139501642"
variation complement(1595)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="g"
/replace="t"
/db_xref="dbSNP:77202950"
exon 1596..1688
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/inference="alignment:Splign:1.39.8"
variation complement(1611)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="g"
/db_xref="dbSNP:61756122"
variation complement(1613)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:144302699"
variation complement(1640)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:200590634"
variation complement(1659)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="g"
/db_xref="dbSNP:142489324"
exon 1689..1829
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/inference="alignment:Splign:1.39.8"
variation complement(1708)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:200905492"
variation complement(1709)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="t"
/db_xref="dbSNP:367854149"
variation complement(1713)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:374040380"
variation complement(1754)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:148494011"
variation complement(1760)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:371012107"
variation complement(1780)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:116722638"
variation complement(1789)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:112872083"
variation complement(1791..1792)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace=""
/replace="cccccccc"
/db_xref="dbSNP:138733588"
variation complement(1824)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:141781729"
exon 1830..1963
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/inference="alignment:Splign:1.39.8"
variation complement(1919)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="g"
/db_xref="dbSNP:139926792"
variation complement(1948)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="g"
/replace="t"
/db_xref="dbSNP:145990724"
variation complement(1961)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:375880092"
exon 1964..2151
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/inference="alignment:Splign:1.39.8"
variation complement(2034)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="g"
/db_xref="dbSNP:201892076"
variation complement(2045)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="c"
/db_xref="dbSNP:61751339"
variation complement(2085)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:138185414"
variation complement(2086)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:150834776"
variation complement(2098)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:200777395"
variation complement(2100)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:375158212"
variation complement(2113)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:372044168"
variation complement(2150)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:369707859"
exon 2152..2268
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/inference="alignment:Splign:1.39.8"
variation complement(2187)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:371706295"
variation complement(2217)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:374449874"
variation complement(2266)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:113608212"
exon 2269..2567
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/inference="alignment:Splign:1.39.8"
variation complement(2288)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="g"
/db_xref="dbSNP:141414455"
variation complement(2333)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:148384795"
variation complement(2348)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:370282092"
variation complement(2349)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="g"
/db_xref="dbSNP:146900414"
variation complement(2354)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="g"
/db_xref="dbSNP:368460255"
variation complement(2357)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:142605965"
variation complement(2404)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:138493671"
variation complement(2450)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:61751338"
variation complement(2457)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="c"
/db_xref="dbSNP:61751337"
variation complement(2463)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:149061794"
variation complement(2483)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:374646043"
variation complement(2494)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:201614203"
variation complement(2502)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:144942373"
variation complement(2517)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="c"
/db_xref="dbSNP:149885647"
variation complement(2520)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:140077767"
variation complement(2528)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:201732861"
variation complement(2553)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:146654145"
variation complement(2555)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:199699766"
exon 2568..2681
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/inference="alignment:Splign:1.39.8"
variation complement(2622)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:373207404"
variation complement(2634)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:143505361"
variation complement(2651)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:200120984"
variation complement(2656)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:375991427"
exon 2682..2820
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/inference="alignment:Splign:1.39.8"
variation complement(2708)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:367859929"
variation complement(2719)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:376900132"
variation complement(2754)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:35147370"
variation complement(2771)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:375285730"
variation complement(2810)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:139946113"
exon 2821..2998
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/inference="alignment:Splign:1.39.8"
variation complement(2959)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="g"
/db_xref="dbSNP:372879919"
variation complement(2970)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:370540387"
variation complement(2992)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="g"
/db_xref="dbSNP:377112892"
exon 2999..3898
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/inference="alignment:Splign:1.39.8"
variation complement(3002)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="g"
/replace="t"
/db_xref="dbSNP:368862259"
variation complement(3052)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:146002237"
variation complement(3054)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:371985812"
variation complement(3058)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:35803045"
variation complement(3061)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:201111479"
variation complement(3069)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="g"
/db_xref="dbSNP:372467190"
variation complement(3080)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:34135902"
variation complement(3086)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="t"
/db_xref="dbSNP:7124834"
variation complement(3088)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:202116197"
variation complement(3093)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:375585822"
variation complement(3105)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="g"
/db_xref="dbSNP:144722829"
variation complement(3114)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:371207748"
variation complement(3117)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:149360555"
variation complement(3118)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:201225431"
variation complement(3119)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:61756123"
variation complement(3132)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:139055389"
variation complement(3141)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="g"
/replace="t"
/db_xref="dbSNP:367647619"
variation complement(3178)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="c"
/db_xref="dbSNP:373803547"
variation complement(3192)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="t"
/db_xref="dbSNP:370431238"
variation complement(3199)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="c"
/replace="t"
/db_xref="dbSNP:150519608"
variation complement(3213)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="t"
/db_xref="dbSNP:377195304"
variation complement(3249)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:116034442"
STS 3269..3385
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/standard_name="SHGC-106541"
/db_xref="UniSTS:169929"
variation complement(3275)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="c"
/db_xref="dbSNP:113258937"
variation complement(3325)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="g"
/db_xref="dbSNP:113679864"
STS 3476..3724
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/standard_name="RH18062"
/db_xref="UniSTS:73995"
variation complement(3522..3523)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace=""
/replace="ca"
/db_xref="dbSNP:36088476"
variation complement(3523..3524)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace=""
/replace="ag"
/db_xref="dbSNP:200207788"
variation complement(3556)
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
/replace="a"
/replace="t"
/db_xref="dbSNP:59685395"
polyA_signal 3870..3875
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
polyA_site 3898
/gene="NUP98"
/gene_synonym="ADIR2; NUP196; NUP96"
ORIGIN
aaccgcggcggcgaggggcgggactccacggccctctcaccgctcctaccctgtgcctccccgaactccttctgcccctcctcttccctctcgccccttcccccttcagttcggtttcaaaagacgcgttgcccaatgaataacagggtcgacccagagtggcggccgcgtccaccaattcgcggacggcgagggcggagcgtccgcaacgagcctctgacgccgggcggcgtgtgacgcagtcgggccctctgcgcgctgcgcccgaagcggcggtcggtggcaggggtggtagcggcggcggcgacggtttcgtgggggccgcgcgctgctctgtgagcggcgggtggcagcaggggactcctgacacttccccttccccaccgaaccgcgctttctgaaacaaagactcattttgaagatgtttaacaaatcatttggaacaccctttgggggtggcacaggtggctttggcacaacttcaacatttggacagaatactggctttggcactactagtggaggggcatttggaacatctgcatttggttctagcaacaatactggaggcctctttggaaattcacagactaaaccaggaggattgtttggaaccagttcatttagccagccagctacctccacaagcactggctttgggtttggtacgtcaacaggaacagcaaataccttgtttggaactgcaagcacagggaccagtctcttctcatcccaaaacaatgcctttgcacaaaataaaccaactggctttggcaattttggaaccagtactagcagtggaggactctttggaaccacaaataccacctctaatccttttggcagcacatctggctccctctttgggccaagtagttttacagctgctcctactgggactactattaaatttaaccctccaactggtacagatactatggtcaaagctggagttagcactaacataagtaccaagcaccagtgtattactgctatgaaagaatatgaaagcaagtcactagaggaacttcgtttagaggattatcaggctaacaggaagggcccacagaaccaggtgggagcaggtaccacaactggcttgtttgggtcttctccagccacttccagcgcaacaggactcttcagctcctccaccactaattcaggctttgcatatggtcagaacaaaactgcctttggaactagtacaactggatttggaacaaatccaggtggtctctttggccaacagaatcagcagactaccagcctcttcagcaaaccatttggccaggctacaaccacccagaacactggcttttcctttggtaataccagcaccataggacagccaagcaccaacaccatgggattatttggagtaacccaagcctcacagcctggaggtctttttgggacagctacaaacaccagcactgggacagcatttggaacaggaacaggtctctttgggcagaccaatactggatttggtgctgttggttcgaccctgtttggcaataacaagcttactacatttggaagcagcacaaccagtgcaccttcatttggtacaaccagtggcgggctctttggttttggcacaaataccagtgggaatagtatttttggaagtaaaccagcacctgggactcttggaactgggcttggtgcaggatttggaacagctcttggtgctggacaggcatctttgtttgggaacaaccaacctaagattggagggcctcttggtacaggagcctttggggcccctggatttaatactacgacagccactttgggctttggagccccccaggccccagtagctttgacagatccaaatgcttctgctgcccagcaggctgttctccagcagcacatcaatagtctaacatactcaccttttggagactctcctctcttccggaatccgatgtcagaccctaagaagaaggaagagagattgaaaccaacaaatccagcagcccagaaggctcttactacacctactcattataaactgacaccccgccctgccactagagtccggccaaaggctttacaaacaacaggcacagccaagtcacatctctttgatgggctggatgacgatgaaccatccctagccaatggagcattcatgcccaagaagagcattaagaagttggttttgaagaaccttaataatagcaatctcttttctcctgttaatcgtgattcagaaaatctagcttcaccatctgaatatccagaaaatggagagagatttagtttcctaagcaaacctgttgatgagaatcaccagcaggatggagatgaagattcccttgtttcacatttttatactaaccctattgccaaacctattcctcaaaccccagaaagtgctggaaataaacacagcaacagcaacagtgtggatgataccattgttgcattaaacatgcgtgctgctttgcgaaatgggctggaaggaagcagtgaagaaacgtcttttcatgatgagtcacttcaggatgaccgagaagaaatagaaaataattcttaccatatgcacccagcaggtattattctcactaaggttggttactatactattccatctatggatgaccttgctaaaattaccaatgaaaaaggagagtgcattgtctctgatttcactattggtcggaaaggttatggttcaatctattttgaaggagatgtgaatttgacaaatctaaatttggatgatattgtgcatatccggaggaaagaagtagttgtctacttagatgataaccaaaaaccacctgtgggtgaagggctaaataggaaggctgaagttacattggatggagtttggccaacagataaaacatctcgttgtttaataaagagcccagatcgccttgctgatatcaactatgaaggaagattggaagcagtttcaaggaaacagggagctcaattcaaagaataccggcctgaaactggttcttgggtgtttaaggtctcccatttttctaagtatggccttcaggattctgatgaagaggaggaggagcatccgtctaaaactagtacaaagaagttgaagactgctcctttgcctcctgcaagccagactacgcccttgcagatggctcttaatggcaaacctgcacctccacctcaggtagagaaaaaaggacagtgaatttgaatggaatccgtgataccgaagttgaaagcaagtcattcagctaatacaaagctgttttatgacccttggaactttgaagagtacaaacattggcaatcacgttgaaacaagtgcaagggagggcgtgaggtcttgcaggcatctgtctttttactggagagatttaaagaattctcttgctgtttggattattcctctacagattgtcatttttaaaccctttgttctctctcatttggacttgctgaattctctgctcagtgattaacttaagatttgctcatgtgggttcatgcacagtaaattctgcctttattgactacctgatgtgcagtttaatctttttctttacctccatggttttttaaaagttaaattagctttctgaaagggtttttaatctccatttttttaaagttgtttgcttatacttcgggtaaccttgatatttgtattttaatagtacataatctttatgaaaaatagtttgggaatgtaaatgaattattatttggcttggggagattagggcctacattgtttatcgcaattacttgtatcattgatacgggatttctttgtaaagcatcctctacctctcagctgctgaaagctagacctttggtattttccatgctataattcttatggctgctgaaatgtgtggtttttatgatttattaaataatctcttaggaggcatttctgaaaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:4928 -> Molecular function: GO:0005215 [transporter activity] evidence: TAS
GeneID:4928 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:4928 -> Molecular function: GO:0017056 [structural constituent of nuclear pore] evidence: IMP
GeneID:4928 -> Molecular function: GO:0017056 [structural constituent of nuclear pore] evidence: NAS
GeneID:4928 -> Molecular function: GO:0042277 [peptide binding] evidence: IEA
GeneID:4928 -> Biological process: GO:0000059 [protein import into nucleus, docking] evidence: NAS
GeneID:4928 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS
GeneID:4928 -> Biological process: GO:0005975 [carbohydrate metabolic process] evidence: TAS
GeneID:4928 -> Biological process: GO:0006260 [DNA replication] evidence: IMP
GeneID:4928 -> Biological process: GO:0006913 [nucleocytoplasmic transport] evidence: TAS
GeneID:4928 -> Biological process: GO:0006999 [nuclear pore organization] evidence: NAS
GeneID:4928 -> Biological process: GO:0007077 [mitotic nuclear envelope disassembly] evidence: TAS
GeneID:4928 -> Biological process: GO:0008645 [hexose transport] evidence: TAS
GeneID:4928 -> Biological process: GO:0010827 [regulation of glucose transport] evidence: TAS
GeneID:4928 -> Biological process: GO:0015758 [glucose transport] evidence: TAS
GeneID:4928 -> Biological process: GO:0016032 [viral process] evidence: TAS
GeneID:4928 -> Biological process: GO:0019048 [modulation by virus of host morphology or physiology] evidence: IEA
GeneID:4928 -> Biological process: GO:0019221 [cytokine-mediated signaling pathway] evidence: TAS
GeneID:4928 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS
GeneID:4928 -> Biological process: GO:0051028 [mRNA transport] evidence: IEA
GeneID:4928 -> Biological process: GO:0051292 [nuclear pore complex assembly] evidence: IMP
GeneID:4928 -> Biological process: GO:0055085 [transmembrane transport] evidence: TAS
GeneID:4928 -> Cellular component: GO:0000776 [kinetochore] evidence: IDA
GeneID:4928 -> Cellular component: GO:0005635 [nuclear envelope] evidence: IDA
GeneID:4928 -> Cellular component: GO:0005635 [nuclear envelope] evidence: TAS
GeneID:4928 -> Cellular component: GO:0005643 [nuclear pore] evidence: IDA
GeneID:4928 -> Cellular component: GO:0005643 [nuclear pore] evidence: NAS
GeneID:4928 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
GeneID:4928 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:4928 -> Cellular component: GO:0031080 [nuclear pore outer ring] evidence: IDA
GeneID:4928 -> Cellular component: GO:0031080 [nuclear pore outer ring] evidence: NAS
GeneID:4928 -> Cellular component: GO:0031965 [nuclear membrane] evidence: IDA
GeneID:4928 -> Cellular component: GO:0034399 [nuclear periphery] evidence: IDA
GeneID:4928 -> Cellular component: GO:0042405 [nuclear inclusion body] evidence: IDA
GeneID:4928 -> Cellular component: GO:0044615 [nuclear pore nuclear basket] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.