GGRNA Home | Help | Advanced search

2025-05-09 19:33:28, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_030763               2126 bp    mRNA    linear   PRI 09-JUN-2013
DEFINITION  Homo sapiens high mobility group nucleosome binding domain 5
            (HMGN5), mRNA.
ACCESSION   NM_030763
VERSION     NM_030763.2  GI:254028191
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2126)
  AUTHORS   Zhang,X.Y., Guo,Z.Q., Ji,S.Q., Zhang,M., Jiang,N., Li,X.S. and
            Zhou,L.Q.
  TITLE     Small interfering RNA targeting HMGN5 induces apoptosis via
            modulation of a mitochondrial pathway and Bcl-2 family proteins in
            prostate cancer cells
  JOURNAL   Asian J. Androl. 14 (3), 487-492 (2012)
   PUBMED   22504871
  REMARK    GeneRIF: HMGN5 may be a potential molecular target with therapeutic
            relevance for the treatment of prostate cancer.
REFERENCE   2  (bases 1 to 2126)
  AUTHORS   Chen,P., Wang,X.L., Ma,Z.S., Xu,Z., Jia,B., Ren,J., Hu,Y.X.,
            Zhang,Q.H., Ma,T.G., Yan,B.D., Yan,Q.Z., Li,Y.L., Li,Z., Yu,J.Y.,
            Gao,R., Fan,N., Li,B. and Yang,J.L.
  TITLE     Knockdown of HMGN5 expression by RNA interference induces cell
            cycle arrest in human lung cancer cells
  JOURNAL   Asian Pac. J. Cancer Prev. 13 (7), 3223-3228 (2012)
   PUBMED   22994738
  REMARK    GeneRIF: HMGN5 silencing to significantly inhibit A549 and H1299
            cell proliferation.
REFERENCE   3  (bases 1 to 2126)
  AUTHORS   Ji,S.Q., Yao,L., Zhang,X.Y., Li,X.S. and Zhou,L.Q.
  TITLE     Knockdown of the nucleosome binding protein 1 inhibits the growth
            and invasion of clear cell renal cell carcinoma cells in vitro and
            in vivo
  JOURNAL   J. Exp. Clin. Cancer Res. 31, 22 (2012)
   PUBMED   22420896
  REMARK    GeneRIF: NSBP1 plays oncogenic role in clear cell renal cell
            carcinoma (ccRCC) by promoting cell proliferation and invasion.
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 2126)
  AUTHORS   Wahafu,W., He,Z.S., Zhang,X.Y., Zhang,C.J., Yao,K., Hao,H.,
            Song,G., He,Q., Li,X.S. and Zhou,L.Q.
  TITLE     The nucleosome binding protein NSBP1 is highly expressed in human
            bladder cancer and promotes the proliferation and invasion of
            bladder cancer cells
  JOURNAL   Tumour Biol. 32 (5), 931-939 (2011)
   PUBMED   21695596
  REMARK    GeneRIF: these results suggest that NSBP1 promotes the viability of
            bladder cancer cells through increased cell proliferation
REFERENCE   5  (bases 1 to 2126)
  AUTHORS   Malicet,C., Rochman,M., Postnikov,Y. and Bustin,M.
  TITLE     Distinct properties of human HMGN5 reveal a rapidly evolving but
            functionally conserved nucleosome binding protein
  JOURNAL   Mol. Cell. Biol. 31 (13), 2742-2755 (2011)
   PUBMED   21518955
  REMARK    GeneRIF: HMGN5 has a highly disordered structure, binds dynamically
            to nucleosome core particles, modulates the binding of H1 to
            chromatin, reduces the compaction of the chromatin fiber, and
            affects transcription.
REFERENCE   6  (bases 1 to 2126)
  AUTHORS   Jiang,N., Zhou,L.Q. and Zhang,X.Y.
  TITLE     Downregulation of the nucleosome-binding protein 1 (NSBP1) gene can
            inhibit the in vitro and in vivo proliferation of prostate cancer
            cells
  JOURNAL   Asian J. Androl. 12 (5), 709-717 (2010)
   PUBMED   20531280
  REMARK    GeneRIF: A positive correlation was observed between NSBP1
            expression and cell proliferation and apoptosis in DU145 cells.
REFERENCE   7  (bases 1 to 2126)
  AUTHORS   Rochman,M., Malicet,C. and Bustin,M.
  TITLE     HMGN5/NSBP1: a new member of the HMGN protein family that affects
            chromatin structure and function
  JOURNAL   Biochim. Biophys. Acta 1799 (1-2), 86-92 (2010)
   PUBMED   20123071
  REMARK    GeneRIF: The structure of the HMGN5 gene and the known properties
            of the HMGN5 protein, are described.
            Review article
REFERENCE   8  (bases 1 to 2126)
  AUTHORS   Rochman,M., Postnikov,Y., Correll,S., Malicet,C., Wincovitch,S.,
            Karpova,T.S., McNally,J.G., Wu,X., Bubunenko,N.A., Grigoryev,S. and
            Bustin,M.
  TITLE     The interaction of NSBP1/HMGN5 with nucleosomes in euchromatin
            counteracts linker histone-mediated chromatin compaction and
            modulates transcription
  JOURNAL   Mol. Cell 35 (5), 642-656 (2009)
   PUBMED   19748358
REFERENCE   9  (bases 1 to 2126)
  AUTHORS   Rush,J., Moritz,A., Lee,K.A., Guo,A., Goss,V.L., Spek,E.J.,
            Zhang,H., Zha,X.M., Polakiewicz,R.D. and Comb,M.J.
  TITLE     Immunoaffinity profiling of tyrosine phosphorylation in cancer
            cells
  JOURNAL   Nat. Biotechnol. 23 (1), 94-101 (2005)
   PUBMED   15592455
REFERENCE   10 (bases 1 to 2126)
  AUTHORS   King,L.M. and Francomano,C.A.
  TITLE     Characterization of a human gene encoding nucleosomal binding
            protein NSBP1
  JOURNAL   Genomics 71 (2), 163-173 (2001)
   PUBMED   11161810
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AK094058.1, DA745749.1 and
            AF250329.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Jul 16, 2009 this sequence version replaced gi:13540522.
            
            Summary: This gene encodes a nuclear protein with similarities to
            the high mobility group proteins, HMG14 and HMG17, which suggests
            that this protein may function as a nucleosomal binding and
            transcriptional activating protein. [provided by RefSeq, Sep 2009].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK094058.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-85                AK094058.1         1-85
            86-596              DA745749.1         55-565
            597-2126            AF250329.1         336-1865
FEATURES             Location/Qualifiers
     source          1..2126
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="X"
                     /map="Xq13.3"
     gene            1..2126
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /note="high mobility group nucleosome binding domain 5"
                     /db_xref="GeneID:79366"
                     /db_xref="HGNC:8013"
                     /db_xref="HPRD:02310"
                     /db_xref="MIM:300385"
     exon            1..206
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /inference="alignment:Splign:1.39.8"
     exon            207..344
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    315..317
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /note="upstream in-frame stop codon"
     CDS             330..1178
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /note="nucleosomal binding protein 1; high-mobility group
                     nucleosome binding domain 5; nucleosome-binding protein 1"
                     /codon_start=1
                     /product="high mobility group nucleosome-binding
                     domain-containing protein 5"
                     /protein_id="NP_110390.1"
                     /db_xref="GI:13540523"
                     /db_xref="CCDS:CCDS14448.1"
                     /db_xref="GeneID:79366"
                     /db_xref="HGNC:8013"
                     /db_xref="HPRD:02310"
                     /db_xref="MIM:300385"
                     /translation="
MPKRKAAGQGDMRQEPKRRSARLSAMLVPVTPEVKPKRTSSSRKMKTKSDMMEENIDTSAQAVAETKQEAVVEEDYNENAKNGEAKITEAPASEKEIVEVKEENIEDATEKGGEKKEAVAAEVKNEEEDQKEDEEDQNEEKGEAGKEDKDEKGEEDGKEDKNGNEKGEDAKEKEDGKKGEDGKGNGEDGKEKGEDEKEEEDRKETGDGKENEDGKEKGDKKEGKDVKVKEDEKEREDGKEDEGGNEEEAGKEKEDLKEEEEGKEEDEIKEDDGKKEEPQSIV
"
     misc_feature    333..608
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /note="HMG14 and HMG17; Region: HMG14_17; pfam01101"
                     /db_xref="CDD:201597"
     misc_feature    420..422
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine; propagated from
                     UniProtKB/Swiss-Prot (P82970.1); phosphorylation site"
     misc_feature    555..557
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphotyrosine; propagated from
                     UniProtKB/Swiss-Prot (P82970.1); phosphorylation site"
     misc_feature    555..557
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
                     /citation=[9]
     exon            345..374
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(352)
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142173136"
     variation       complement(364)
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138950278"
     exon            375..404
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /inference="alignment:Splign:1.39.8"
     exon            405..458
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(408)
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:73631719"
     variation       complement(414)
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374413319"
     variation       complement(428)
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73231013"
     exon            459..596
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(531)
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148090107"
     exon            597..2126
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(609..610)
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:59584935"
     variation       complement(658)
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143679569"
     variation       complement(696)
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148928737"
     variation       complement(794)
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:147858164"
     variation       complement(824)
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144502161"
     variation       complement(840)
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142186197"
     variation       complement(875)
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374637006"
     variation       complement(957)
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150302618"
     variation       complement(1040)
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369429467"
     variation       complement(1075)
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186732408"
     variation       complement(1162)
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41310713"
     variation       complement(1333)
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184579787"
     variation       complement(1351)
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:41300251"
     variation       complement(1492)
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:41300259"
     variation       complement(1698)
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:68183777"
     polyA_signal    1738..1743
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
     polyA_site      1759
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
     variation       complement(2033)
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148228755"
     variation       complement(2036)
                     /gene="HMGN5"
                     /gene_synonym="NBP-45; NSBP1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:199672193"
ORIGIN      
aatagcaccgcgagatctgttgaaacattgatttttgacgattccttccctgagaagagggcgaggagaagaagaaagaaaaaggagaactgaattgaattagattagcatgaaggaccttttcacgcggagactaaaagtactgcgcataacttcctgctcagaaatatatgcaaataagaagacagatcctgaaagagcaagctaggagagtacaggtcgtgctgcagttagttcattgaaaactcatttgctcttggagcagtcaggcagtgactgccttcggctttttttctgctgactaagatctcctatagagagctacaacaatgcccaaaagaaaggctgcaggtcaaggtgatatgaggcaggagccaaagagaagatctgccaggttgtctgctatgcttgtgccagttacaccagaggtgaagcctaaaagaacatcaagttcaaggaaaatgaagacaaaaagtgatatgatggaagaaaacatagatacaagtgcccaagcagttgctgaaaccaagcaagaagcagttgttgaagaagactacaatgaaaatgctaaaaatggagaagccaaaattacagaggcaccagcttctgaaaaagaaattgtggaagtaaaagaagaaaatattgaagatgccacagaaaagggaggagaaaagaaagaagcagtggcagcagaagtaaaaaatgaagaagaagatcagaaagaagatgaagaagatcaaaacgaagagaaaggggaagctggaaaagaagacaaagatgaaaaaggggaagaagatggaaaagaggataaaaatggaaatgagaaaggagaagatgcaaaagagaaagaagatggaaaaaaaggtgaagacggaaaaggaaatggagaagatggaaaagagaaaggagaagatgaaaaagaggaagaagacagaaaagaaacaggagatggaaaagagaatgaagatggaaaagagaagggagataaaaaagaggggaaagatgtaaaagtcaaagaagatgaaaaagagagagaagatggaaaagaagatgaaggtggaaatgaggaagaagctggaaaagagaaagaagatttaaaagaagaggaagaaggaaaagaggaagatgagatcaaagaagatgatggaaaaaaagaggagccacagagtattgtttaaaactgccctatgtagtttcataatttggtaacatgtaccttcatgttgtaaagttaatagagataaatatttttatcaaaaattttataaacacagcctttctttagcattgatttaatttcagaacatcttcatattgattattagccataaagtttctaacatgaaacatttatctataaattttgtgattatagtagtggaatacatagaaaaaaatatgctttcaactttgtgagtgaatttcgtgttgtgtaagttatatgtcaaatctttgaattttaattttactcttttatacatgtgataatttcataaagtgagggatcccaaaaaaagagtttcatccaacattcttgttctgcaggttgcttttataaagaaggtgaactattttcatgtaatgttaagagttaaacttatctttcccaaatataactttattattagcttgggaaaaatgaaattgtattcccatttttaaaataaatacaaatgtttatttcagaagggcagttttgattatatgtgaatacacaaattttactggatttatcttaataaaaagactctgacgatgattgtgttttgttatatcttcaaaaatatagctagtgaaatattgtgcttaatttttttctattgtgttattcatgaaaatatttaatattcactgacataaaattaatataaagtaaaattcaccattttaattataataaaaataaagtatataattcaatggttgtcagtatattcacaatgttgtgtccactgtttaattccagagaatttttatcacccaaataagaaacaaagcaccaattagcagtctcttcccattttcgcccaacttatcccccacctccatcccttggcaaccactaatctgccttctatctctatggatttgcctattctgaacatttattataaatggaatcacat
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:79366 -> Molecular function: GO:0003682 [chromatin binding] evidence: NAS
            GeneID:79366 -> Molecular function: GO:0031492 [nucleosomal DNA binding] evidence: IEA
            GeneID:79366 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
            GeneID:79366 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: NAS
            GeneID:79366 -> Biological process: GO:0006357 [regulation of transcription from RNA polymerase II promoter] evidence: IEA
            GeneID:79366 -> Biological process: GO:0016568 [chromatin modification] evidence: IEA
            GeneID:79366 -> Biological process: GO:0045893 [positive regulation of transcription, DNA-dependent] evidence: NAS
            GeneID:79366 -> Cellular component: GO:0000785 [chromatin] evidence: IEA
            GeneID:79366 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:79366 -> Cellular component: GO:0005634 [nucleus] evidence: NAS
            GeneID:79366 -> Cellular component: GO:0005654 [nucleoplasm] evidence: IEA
            GeneID:79366 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
            GeneID:79366 -> Cellular component: GO:0043231 [intracellular membrane-bounded organelle] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.