Home |
Help |
Advanced search
2025-05-09 19:39:21, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_022899 3629 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens ARP8 actin-related protein 8 homolog (yeast) (ACTR8),
mRNA.
ACCESSION NM_022899
VERSION NM_022899.4 GI:296010797
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3629)
AUTHORS Gerhold,C.B., Winkler,D.D., Lakomek,K., Seifert,F.U., Fenn,S.,
Kessler,B., Witte,G., Luger,K. and Hopfner,K.P.
TITLE Structure of Actin-related protein 8 and its contribution to
nucleosome binding
JOURNAL Nucleic Acids Res. 40 (21), 11036-11046 (2012)
PUBMED 22977180
REMARK GeneRIF: Binding studies reveal that Arp8 and the
Arp8-Arp4-actin-HSA sub-complex of INO80 strongly prefer
nucleosomes and H3-H4 tetramers over H2A-H2B dimers, suggesting
that Arp8 functions as a nucleosome recognition module.
REFERENCE 2 (bases 1 to 3629)
AUTHORS Casabonne,D., Reina,O., Benavente,Y., Becker,N., Maynadie,M.,
Foretova,L., Cocco,P., Gonzalez-Neira,A., Nieters,A., Boffetta,P.,
Middeldorp,J.M. and de Sanjose,S.
TITLE Single nucleotide polymorphisms of matrix metalloproteinase 9
(MMP9) and tumor protein 73 (TP73) interact with Epstein-Barr virus
in chronic lymphocytic leukemia: results from the European
case-control study EpiLymph
JOURNAL Haematologica 96 (2), 323-327 (2011)
PUBMED 21048031
REMARK GeneRIF: Observational study of gene-disease association and
gene-environment interaction. (HuGE Navigator)
REFERENCE 3 (bases 1 to 3629)
AUTHORS Kashiwaba,S., Kitahashi,K., Watanabe,T., Onoda,F., Ohtsu,M. and
Murakami,Y.
TITLE The mammalian INO80 complex is recruited to DNA damage sites in an
ARP8 dependent manner
JOURNAL Biochem. Biophys. Res. Commun. 402 (4), 619-625 (2010)
PUBMED 20971067
REMARK GeneRIF: These results suggest that ARP8 is required for the
recruitment of the mammalian INO80 complex to the laser-induced DNA
damage sites.
REFERENCE 4 (bases 1 to 3629)
AUTHORS Yao,T., Song,L., Jin,J., Cai,Y., Takahashi,H., Swanson,S.K.,
Washburn,M.P., Florens,L., Conaway,R.C., Cohen,R.E. and
Conaway,J.W.
TITLE Distinct modes of regulation of the Uch37 deubiquitinating enzyme
in the proteasome and in the Ino80 chromatin-remodeling complex
JOURNAL Mol. Cell 31 (6), 909-917 (2008)
PUBMED 18922472
REFERENCE 5 (bases 1 to 3629)
AUTHORS Aoyama,N., Oka,A., Kitayama,K., Kurumizaka,H. and Harata,M.
TITLE The actin-related protein hArp8 accumulates on the mitotic
chromosomes and functions in chromosome alignment
JOURNAL Exp. Cell Res. 314 (4), 859-868 (2008)
PUBMED 18163988
REMARK GeneRIF: Expression of truncated hArp8 proteins and depletion of
endogenous hArp8 by RNA interference caused misalignment of mitotic
chromosomes, suggesting that chromosome-associated hArp8 has a role
in chromosome behavior.
REFERENCE 6 (bases 1 to 3629)
AUTHORS Wu,S., Shi,Y., Mulligan,P., Gay,F., Landry,J., Liu,H., Lu,J.,
Qi,H.H., Wang,W., Nickoloff,J.A., Wu,C. and Shi,Y.
TITLE A YY1-INO80 complex regulates genomic stability through homologous
recombination-based repair
JOURNAL Nat. Struct. Mol. Biol. 14 (12), 1165-1172 (2007)
PUBMED 18026119
REFERENCE 7 (bases 1 to 3629)
AUTHORS Jin,J., Cai,Y., Yao,T., Gottschalk,A.J., Florens,L., Swanson,S.K.,
Gutierrez,J.L., Coleman,M.K., Workman,J.L., Mushegian,A.,
Washburn,M.P., Conaway,R.C. and Conaway,J.W.
TITLE A mammalian chromatin remodeling complex with similarities to the
yeast INO80 complex
JOURNAL J. Biol. Chem. 280 (50), 41207-41212 (2005)
PUBMED 16230350
REFERENCE 8 (bases 1 to 3629)
AUTHORS Hassel,S., Eichner,A., Yakymovych,M., Hellman,U., Knaus,P. and
Souchelnytskyi,S.
TITLE Proteins associated with type II bone morphogenetic protein
receptor (BMPR-II) and identified by two-dimensional gel
electrophoresis and mass spectrometry
JOURNAL Proteomics 4 (5), 1346-1358 (2004)
PUBMED 15188402
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
DA453867.1, AK022996.1 and AC012467.9.
On May 13, 2010 this sequence version replaced gi:39812114.
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
##Evidence-Data-START##
Transcript exon combination :: AK022996.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-50 DA453867.1 1-50
51-1887 AK022996.1 1-1837
1888-3629 AC012467.9 47289-49030
FEATURES Location/Qualifiers
source 1..3629
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="3"
/map="3p21.31"
gene 1..3629
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/note="ARP8 actin-related protein 8 homolog (yeast)"
/db_xref="GeneID:93973"
/db_xref="HGNC:14672"
/db_xref="HPRD:09792"
exon 1..224
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/inference="alignment:Splign:1.39.8"
CDS 102..1976
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/note="INO80 complex subunit N"
/codon_start=1
/product="actin-related protein 8"
/protein_id="NP_075050.3"
/db_xref="GI:39812115"
/db_xref="CCDS:CCDS2875.1"
/db_xref="GeneID:93973"
/db_xref="HGNC:14672"
/db_xref="HPRD:09792"
/translation="
MTQAEKGDTENGKEKGGEKEKEQRGVKRPIVPALVPESLQEQIQSNFIIVIHPGSTTLRIGRATDTLPASIPHVIARRHKQQGQPLYKDSWLLREGLNKPESNEQRQNGLKMVDQAIWSKKMSNGTRRIPVSPEQARSYNKQMRPAILDHCSGNKWTNTSHHPEYLVGEEALYVNPLDCYNIHWPIRRGQLNIHPGPGGSLTAVLADIEVIWSHAIQKYLEIPLKDLKYYRCILLIPDIYNKQHVKELVNMILMKMGFSGIVVHQESVCATYGSGLSSTCIVDVGDQKTSVCCVEDGVSHRNTRLCLAYGGSDVSRCFYWLMQRAGFPYRECQLTNKMDCLLLQHLKETFCHLDQDISGLQDHEFQIRHPDSPALLYQFRLGDEKLQAPMALFYPATFGIVGQKMTTLQHRSQGDPEDPHDEHYLLATQSKQEQSAKATADRKSASKPIGFEGDLRGQSSDLPERLHSQEVDLGSAQGDGLMAGNDSEEALTALMSRKTAISLFEGKALGLDKAILHSIDCCSSDDTKKKMYSSILVVGGGLMFHKAQEFLQHRILNKMPPSFRRIIENVDVITRPKDMDPRLIAWKGGAVLACLDTTQELWIYQREWQRFGVRMLRERAAFVW
"
misc_feature 495..497
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9H981.2); phosphorylation site"
misc_feature 495..497
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 600..1958
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/note="Actin and related proteins [Cytoskeleton]; Region:
COG5277"
/db_xref="CDD:34874"
misc_feature 678..>992
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/note="Nucleotide-Binding Domain of the sugar
kinase/HSP70/actin superfamily; Region:
NBD_sugar-kinase_HSP70_actin; cd00012"
/db_xref="CDD:212657"
misc_feature 1335..1337
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q9H981.2); phosphorylation site"
misc_feature <1626..1961
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/note="Nucleotide-Binding Domain of the sugar
kinase/HSP70/actin superfamily; Region:
NBD_sugar-kinase_HSP70_actin; cl17037"
/db_xref="CDD:214262"
exon 225..395
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/inference="alignment:Splign:1.39.8"
exon 396..506
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/inference="alignment:Splign:1.39.8"
exon 507..611
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/inference="alignment:Splign:1.39.8"
exon 612..785
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/inference="alignment:Splign:1.39.8"
exon 786..879
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/inference="alignment:Splign:1.39.8"
exon 880..1012
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/inference="alignment:Splign:1.39.8"
exon 1013..1166
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/inference="alignment:Splign:1.39.8"
exon 1167..1262
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/inference="alignment:Splign:1.39.8"
exon 1263..1403
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/inference="alignment:Splign:1.39.8"
exon 1404..1668
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/inference="alignment:Splign:1.39.8"
variation 1619
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/replace="a"
/replace="g"
/db_xref="dbSNP:1046677"
exon 1669..1832
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/inference="alignment:Splign:1.39.8"
exon 1833..3629
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/inference="alignment:Splign:1.39.8"
variation 1997
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/replace="c"
/replace="t"
/db_xref="dbSNP:1046686"
variation 2498
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/replace="g"
/replace="t"
/db_xref="dbSNP:201451819"
STS 2535..2636
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/standard_name="WI-14906"
/db_xref="UniSTS:6233"
variation 3111
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/replace="c"
/replace="t"
/db_xref="dbSNP:2241806"
STS 3177..3318
/gene="ACTR8"
/gene_synonym="ARP8; hArp8; INO80N"
/standard_name="RH99050"
/db_xref="UniSTS:88303"
ORIGIN
gactgtgggcagccggccgtgcgcctgcgcggtggcccttccatcccggcagtcgtggctgcagcgctgaggcgagaggttggtgggtgtctccggccataatgacccaggctgagaagggtgatacggagaacggaaaggagaagggcggcgagaaggagaaggagcagcgcggcgtgaagcggcccatcgtgcccgcgctggtgccggagtcgctgcaagagcaaatccagagcaacttcatcattgtcatacatccaggttcaacaactttaaggattggtcgagccacagacactcttcctgccagcattcctcacgtcattgcccgaagacacaaacaacaagggcagcccctatacaaggacagttggctcctaagggagggactaaataaaccagaaagtaatgaacaaagacaaaatggccttaaaatggtggatcaagcaatatggtctaaaaagatgtccaatggtacaagacgcattcctgtgtcccctgaacaggcacgctcctacaataagcagatgcgacctgcaattttagatcactgttcgggaaataagtggacaaacacatctcatcaccctgagtatttagtaggagaagaggccttgtatgttaatccactggactgttacaatattcactggcctatcagaagaggtcagttaaatattcacccaggccctgggggctctcttacagctgttctggcagatattgaagtaatatggtctcatgcgatacaaaaatacttggaaatcccactgaaagatttaaagtattatagatgtatcttgttaattcctgatatctataataagcagcatgtgaaagaactagtgaatatgatactaatgaagatgggtttttcagggattgtggtccatcaggagtctgtgtgtgccacctatggaagtggcttaagcagcacgtgtattgtagacgttggggaccagaagacaagtgtatgctgtgtggaggatggggtgtctcatcggaatactcggctttgtctggcatacggaggatctgatgtgtcaagatgtttttactggctaatgcagcgagctgggttcccttacagagaatgccagttaacaaataaaatggattgtcttcttctgcaacaccttaaagaaactttttgtcatttagatcaggacatctctgggcttcaggaccatgagtttcagattcgacatcctgattctcctgccctgctttaccagtttcgattaggagatgaaaaactgcaggctccaatggctttgttttaccccgcaacttttggaatcgttggacagaaaatgacgactttgcagcacagatctcagggcgatcctgaggatcctcacgatgaacattacctgctggccacacagagcaaacaagaacagtctgcaaaagctactgctgaccgaaagtctgcatccaaacctattggatttgaaggggatcttcgtggccagtcctctgatcttccagaaagactccattcccaggaggtagatttggggtctgcacagggagatggcctgatggccggcaacgattccgaggaggccctcactgcactgatgtccaggaagactgccatctcgctgtttgaaggaaaagccctgggcctggataaagccatcctccatagcatagactgctgttcatctgacgacaccaaaaagaagatgtacagctccatcctagtggtgggaggtggtttgatgtttcataaagctcaagaatttctgcagcacagaattctcaacaaaatgccaccatccttcaggcgaattattgaaaatgtggatgtgatcacaaggcctaaggacatggacccccggctgattgcatggaaaggaggggcagtgttggcttgtttggatacaacacaggaactgtggatttatcagcgagagtggcagcgctttggtgtccgcatgttacgagagcgggctgcgtttgtgtggtgaatggggaggaaatgtcactgccgaagaccaaaaacaagcttcttggtataaaagactcttacagaatatgtgtattgtaatttattgatctggatgcttaagtgtcatggacagtaaatgaatttgaactttatgttgaggacatgacattggtttgaaaatataaactgcttttgagcagtttagtcagggcatttgagaataaataggaactttctcttcagttgtaaactctcttgccctctctcagggtctcataaactccccagtgatgtaaacgttgctattgaaggttctcatgtggtgaagcccttcatttaagttggcttgaatctcatcagcaggcagcctcatgcaaccatgagggatagtatgtgacgagggagaactgtccactcatgccattttctctcttgtctagtatttcattaggatctaaagttgtctgagttaaatgcacttatgtgactcatgtgtcctcttagaatcccaaatagggggaaaaagttttggtggtttttgttttttttttcattttctgttggattacagaaaaagaatgggacccattcaggtctcgatttccaaaggtaaagatggaaggctgggcagactggcttttgttacctgacatgccgtagggtgagcttagaggaagaaagaaaacaatttttatttggccaaaacagaacaaatgctgaaaaggaaatcttgtttttttcctaaagccaaatagaaatgatttgggtataatttaagagtccttgtgttgtacagatatggtgactgatgtagttattaatactaccaacttagtcatcaagcctcaattttcctttacctgaaggattaagtgaaagcttttggagttcatgatgttcagtatgatcagttaaccttaacctctgagcatcctgaagcaaaatctaaataatgcagctattaccactggtggtccaggctctggtgaagccctctgagcccaggaggaagagaaagcattgtccagaggtaggaacacagtctgggagcccagagctctgggaggagtgggaaaatgctgcttcctgctgcttgcttctaggcacctgcttccgccatctcacttaccatggctagagatgggggtgagactggggaaggacaaaagcagggaacagataagtgatggaaatcagaagggaatatagaaagaactctggatgtggagaaatgccggtacctgagcattttgtatcaatgggagtaccctctgtaactgctcagtaggttacaaatgaagagtccaccagtattagaaacaatttaaacttgccagtaccaactgggatgtgtgccttcaatttgaaaattgtatgttttattttttaaatttgttaacagcattaatttatagagtattgatgtcatttatgtttctgaggtgtttcaacacaattttggatcagctgcctgtttgcaaaaacataatatatttctgttaaacagttcttcacctaacagcatattgctcttataactggtagagctgtttcaaaggaagttggtttctggtccaagttttgacctaaaccatgtccatcttctattaccagcacttacaagcactgtgaaaactgatcatgacaaataagtaaaatttgctacattaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:93973 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:93973 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
GeneID:93973 -> Biological process: GO:0006281 [DNA repair] evidence: IEA
GeneID:93973 -> Biological process: GO:0006310 [DNA recombination] evidence: IEA
GeneID:93973 -> Biological process: GO:0006338 [chromatin remodeling] evidence: IEA
GeneID:93973 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
GeneID:93973 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: IEA
GeneID:93973 -> Biological process: GO:0007067 [mitosis] evidence: IEA
GeneID:93973 -> Biological process: GO:0051301 [cell division] evidence: IEA
GeneID:93973 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:93973 -> Cellular component: GO:0031011 [Ino80 complex] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.