GGRNA Home | Help | Advanced search

2025-05-09 19:30:09, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_021942               4564 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens trafficking protein particle complex 11 (TRAPPC11),
            transcript variant 1, mRNA.
ACCESSION   NM_021942
VERSION     NM_021942.5  GI:359718967
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4564)
  AUTHORS   Yu,S. and Liang,Y.
  TITLE     A trapper keeper for TRAPP, its structures and functions
  JOURNAL   Cell. Mol. Life Sci. (2012) In press
   PUBMED   22669257
  REMARK    Publication Status: Available-Online prior to print
REFERENCE   2  (bases 1 to 4564)
  AUTHORS   Scrivens,P.J., Noueihed,B., Shahrzad,N., Hul,S., Brunet,S. and
            Sacher,M.
  TITLE     C4orf41 and TTC-15 are mammalian TRAPP components with a role at an
            early stage in ER-to-Golgi trafficking
  JOURNAL   Mol. Biol. Cell 22 (12), 2083-2093 (2011)
   PUBMED   21525244
REFERENCE   3  (bases 1 to 4564)
  AUTHORS   Wendler,F., Gillingham,A.K., Sinka,R., Rosa-Ferreira,C.,
            Gordon,D.E., Franch-Marro,X., Peden,A.A., Vincent,J.P. and Munro,S.
  TITLE     A genome-wide RNA interference screen identifies two novel
            components of the metazoan secretory pathway
  JOURNAL   EMBO J. 29 (2), 304-314 (2010)
   PUBMED   19942856
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DB096222.1, BX648499.1,
            BX647127.1 and AI034264.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Dec 8, 2011 this sequence version replaced gi:39995075.
            
            Summary: The protein encoded by this gene is a subunit of the TRAPP
            (transport protein particle) tethering complex, which functions in
            intracellular vesicle trafficking. This subunit is involved in
            early stage endoplasmic reticulum-to-Golgi vesicle transport.
            Alternative splicing of this gene results in multiple transcript
            variants. [provided by RefSeq, Jan 2013].
            
            Transcript Variant: This variant (1) represents the longer
            transcript and encodes the longer isoform (a).
            
            ##Evidence-Data-START##
            Transcript exon combination :: BX647127.1, AK096345.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025083, ERS025084 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-26                DB096222.1         1-26
            27-2346             BX648499.1         2-2321
            2347-4547           BX647127.1         2318-4518
            4548-4564           AI034264.1         1-17                c
FEATURES             Location/Qualifiers
     source          1..4564
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="4"
                     /map="4q35.1"
     gene            1..4564
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /note="trafficking protein particle complex 11"
                     /db_xref="GeneID:60684"
                     /db_xref="HGNC:25751"
                     /db_xref="HPRD:10968"
                     /db_xref="MIM:614138"
     exon            1..181
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       31
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186294928"
     variation       77
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190853983"
     variation       110
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111592692"
     exon            182..406
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       196
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370618098"
     variation       197
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113604435"
     CDS             203..3604
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /note="isoform a is encoded by transcript variant 1;
                     gryzun homolog; foie gras homolog; trafficking protein
                     particle complex subunit 11"
                     /codon_start=1
                     /product="trafficking protein particle complex subunit 11
                     isoform a"
                     /protein_id="NP_068761.4"
                     /db_xref="GI:39995076"
                     /db_xref="CCDS:CCDS34112.1"
                     /db_xref="GeneID:60684"
                     /db_xref="HGNC:25751"
                     /db_xref="HPRD:10968"
                     /db_xref="MIM:614138"
                     /translation="
MSPTQWDFPVELCCRPMAFVTLTGLDVVYNAVHRAVWDAFCANRRADRVPISFKVLPGDHEYPKCRPKRTSYEWYIPKGILKTGWMNKHLNLVPALVVVFYELDWDEPQWKEKQSECATRVEIVRQSLQGRNTKVAVVLIQKKTPLPPGEDVIASERAAALCNACELSGKSLFVLPHTDHLVGYIIRLENAFYEHAQTYYYTEIRRVKSHKEFLNKTTHQLLFVRHQFKIAFFSELKQDTQNALKNYRTAYNLVHELRAHETNILEIKTMAGFINYKICRLCFQHNTPLDAIAQFRKHIDLCKKKIGSAELSFEHDAWMSKQFQAFGDLFDEAIKLGLTAIQTQNPGFYYQQAAYYAQERKQLAKTLCNHEASVMYPNPDPLETQTGVLDFYGQRSWRQGILSFDLSDPEKEKVGILAIQLKERNVVHSEIIITLLSNAVAQFKKYKCPRMKSHLMVQMGEEYYYAKDYTKALKLLDYVMCDYRSEGWWTLLTSVLTTALKCSYLMAQLKDYITYSLELLGRASTLKDDQKSRIEKNLINVLMNESPDPEPDCDILAVKTAQKLWADRISLAGSNIFTIGVQDFVPFVQCKAKFHAPSFHVDVPVQFDIYLKADCPHPIRFSKLCVSFNNQEYNQFCVIEEASKANEVLENLTQGKMCLVPGKTRKLLFKFVAKTEDVGKKIEITSVDLALGNETGRCVVLNWQGGGGDAASSQEALQAARSFKRRPKLPDNEVHWDSIIIQASTMIISRVPNISVHLLHEPPALTNEMYCLVVTVQSHEKTQIRDVKLTAGLKPGQDANLTQKTHVTLHGTELCDESYPALLTDIPVGDLHPGEQLEKMLYVRCGTVGSRMFLVYVSYLINTTVEEKEIVCKCHKDETVTIETVFPFDVAVKFVSTKFEHLERVYADIPFLLMTDLLSASPWALTIVSSELQLAPSMTTVDQLESQVDNVILQTGESASECFCLQCPSLGNIEGGVATGHYIISWKRTSAMENIPIITTVITLPHVIVENIPLHVNADLPSFGRVRESLPVKYHLQNKTDLVQDVEISVEPSDAFMFSGLKQIRLRILPGTEQEMLYNFYPLMAGYQQLPSLNINLLRFPNFTNQLLRRFIPTSIFVKPQGRLMDDTSIAAA
"
     misc_feature    935..937
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine; propagated from
                     UniProtKB/Swiss-Prot (Q7Z392.2); acetylation site"
     misc_feature    989..1768
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /note="Foie gras liver health family 1; Region:
                     Foie-gras_1; pfam11817"
                     /db_xref="CDD:192842"
     misc_feature    1931..>2305
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /note="Gryzun, putative trafficking through Golgi; Region:
                     Gryzun; pfam07919"
                     /db_xref="CDD:191893"
     misc_feature    <2936..3493
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /note="Gryzun, putative trafficking through Golgi; Region:
                     Gryzun; pfam07919"
                     /db_xref="CDD:191893"
     misc_feature    3305..3487
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /note="Gryzun, putative Golgi trafficking; Region:
                     Gryzun-like; pfam12742"
                     /db_xref="CDD:193218"
     variation       246
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368097747"
     variation       251
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149829052"
     variation       259
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370789553"
     variation       316
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140219590"
     variation       319
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145842147"
     variation       320
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199564084"
     variation       344
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150331292"
     variation       347
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141909783"
     variation       353
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141053214"
     variation       372
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375826055"
     variation       385
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144878889"
     exon            407..576
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       421
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138760818"
     variation       431
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149339392"
     variation       472
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:60142264"
     variation       484
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148105529"
     variation       553
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372764730"
     variation       560
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376462004"
     variation       561
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367769488"
     exon            577..647
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       586
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369613803"
     variation       606
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:141880154"
     variation       607
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375901783"
     exon            648..762
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       652
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147280840"
     variation       694
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368033997"
     variation       728
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199967169"
     variation       732
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:140909414"
     variation       742
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114853790"
     exon            763..862
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       766
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377678506"
     variation       799
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373475855"
     variation       821
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201181808"
     variation       829
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200367113"
     exon            863..936
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       877
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73872657"
     variation       930
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373207427"
     variation       931
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369901430"
     exon            937..1033
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       950
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368397954"
     variation       1010
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147526528"
     variation       1031
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368689327"
     exon            1034..1167
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       1040
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200646990"
     variation       1057
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:139419771"
     variation       1087
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371401679"
     variation       1088
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374498633"
     variation       1090
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:34767735"
     variation       1099
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:62357990"
     variation       1100
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138722849"
     variation       1119
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367938699"
     variation       1129
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4241779"
     variation       1133
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148833310"
     variation       1162
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371688110"
     exon            1168..1315
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       1189
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142558431"
     variation       1260
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200078740"
     variation       1281
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146470172"
     variation       1309
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140959482"
     variation       1312
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144785855"
     exon            1316..1409
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       1316
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372479687"
     variation       1337
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201932605"
     variation       1350
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138740048"
     variation       1359
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376987315"
     variation       1363
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369104172"
     variation       1394
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140403642"
     exon            1410..1489
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       1422
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375379302"
     variation       1446
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150383310"
     variation       1477
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376944145"
     variation       1479
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201263451"
     exon            1490..1568
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       1498
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138134740"
     variation       1507
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373944670"
     variation       1531
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368173953"
     variation       1537
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:60648156"
     variation       1539
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149572534"
     variation       1540
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202186437"
     variation       1543
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202220969"
     variation       1546
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147260246"
     variation       1549
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141205658"
     variation       1551
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201387237"
     exon            1569..1623
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       1597
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373372697"
     variation       1603
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202145488"
     variation       1611
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200956431"
     exon            1624..1769
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       1729
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368801039"
     variation       1732
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139154209"
     exon            1770..1831
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       1800
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201440313"
     variation       1813
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199634473"
     variation       1827
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376489209"
     variation       1830
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370129357"
     exon            1832..1964
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       1856
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374195797"
     variation       1904
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200561007"
     variation       1905
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147516606"
     variation       1937
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368529822"
     exon            1965..2095
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       1968
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146053783"
     variation       1988..1989
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:34788117"
     variation       2026
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369696357"
     exon            2096..2251
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       2103
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148567547"
     variation       2116
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202077324"
     variation       2121
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372385350"
     variation       2180
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:67383011"
     variation       2201
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185988689"
     exon            2252..2439
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       2279
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374682349"
     variation       2297
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376585316"
     variation       2347
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:139034513"
     variation       2349
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143990563"
     variation       2371
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146441514"
     variation       2377
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140919627"
     variation       2382
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371182334"
     variation       2384
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143344834"
     variation       2398
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375844076"
     exon            2440..2588
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       2444
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368432060"
     variation       2479
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199804527"
     variation       2488
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372771070"
     variation       2489
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201179987"
     variation       2522
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146718854"
     variation       2561
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148885349"
     variation       2569
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374752326"
     variation       2572
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4862234"
     exon            2589..2710
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       2590
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:151021715"
     variation       2601
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140915279"
     variation       2612
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111423902"
     variation       2620
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146402163"
     variation       2621
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139113789"
     variation       2624
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:184925550"
     variation       2627
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369402916"
     variation       2636
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:62358032"
     variation       2663
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114471872"
     variation       2685
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75176151"
     variation       2691
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200068440"
     variation       2710
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201868142"
     exon            2711..2830
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       2732
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:149626892"
     variation       2753
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369752120"
     variation       2801
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144365310"
     exon            2831..2896
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       2839
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148799732"
     variation       2849
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142313888"
     variation       2853
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373484248"
     variation       2858
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376514277"
     variation       2876
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369077324"
     variation       2886
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200931036"
     exon            2897..3053
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       2946
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200936990"
     variation       2947
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200191432"
     variation       2987
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200421641"
     variation       2991
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139826587"
     variation       2996
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376022413"
     variation       3001
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:62617790"
     variation       3013
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368829322"
     variation       3027
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202094535"
     variation       3034
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371763250"
     variation       3035
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200260429"
     variation       3046
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151179289"
     variation       3051
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202170132"
     variation       3052
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376728526"
     exon            3054..3165
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       3077
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375415831"
     variation       3100
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139144320"
     variation       3120
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370024286"
     variation       3137
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201344261"
     variation       3139
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200546920"
     exon            3166..3257
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       3204
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200989029"
     variation       3220
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149934183"
     variation       3221
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:79804817"
     variation       3240
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:77044048"
     variation       3241
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:75104564"
     variation       3242
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79057512"
     variation       3243
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:74598240"
     exon            3258..3391
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       3264
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371103166"
     variation       3265
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142298713"
     variation       3276
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374203755"
     variation       3288
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201494083"
     variation       3294
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200466260"
     variation       3326
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:146219211"
     variation       3385
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373951254"
     exon            3392..3559
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       3401
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374734783"
     variation       3409
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:147872774"
     variation       3413
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141588557"
     variation       3417
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147061560"
     variation       3418
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148114592"
     variation       3423
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368699954"
     variation       3435
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372371594"
     variation       3475
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113269326"
     variation       3506
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201906372"
     variation       3512
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78663235"
     variation       3531
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369105119"
     variation       3544
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368766677"
     exon            3560..4554
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /inference="alignment:Splign:1.39.8"
     variation       3561
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138928797"
     variation       3602
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142222368"
     variation       3614
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373447557"
     variation       3615
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376809612"
     variation       3658
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373719187"
     variation       3766
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141091250"
     variation       3790
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150159419"
     variation       3879
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372956047"
     variation       3982
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145640453"
     variation       4079
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374746128"
     variation       4083
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376123960"
     variation       4095
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148811548"
     variation       4140
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:78106466"
     variation       4162
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192368056"
     variation       4235..4236
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35034292"
     variation       4273
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:143470714"
     STS             4334..4517
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /standard_name="RH103089"
                     /db_xref="UniSTS:97423"
     STS             4334..4477
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /standard_name="SHGC-44350"
                     /db_xref="UniSTS:71825"
     STS             4342..4517
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /standard_name="D20S722"
                     /db_xref="UniSTS:78628"
     polyA_signal    4529..4534
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
     variation       4548
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12642166"
     polyA_site      4549
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
     polyA_site      4554
                     /gene="TRAPPC11"
                     /gene_synonym="C4orf41; FOIGR; GRY"
ORIGIN      
aaagtgcttcctgtgccgggggaggtgggtacagggaagtctcgcctgttggaactggctgtggggctgcggcggtggggacgggccacggcgttctgtgacatccccccgcctcccctcgtcttctcccggctggcggcgaccggcctcagctgcagcgggcccggggcgtggggcctgggttttttgtgacatcgtaaacatgagccccacacagtgggacttccctgtggaattatgttgccggcctatggcctttgttactctaacgggcctggatgtagtttataatgcagtccatcgagctgtctgggacgccttctgtgcaaatcggagagctgatcgagtaccaatttctttcaaggtgctcccaggtgaccatgagtatcccaaatgtagacccaagagaacttcatatgagtggtacattcctaaagggatcttaaagactggctggatgaataagcatctgaatctggtgccagccctggtggttgtgttctatgaactggactgggatgagcctcagtggaaagaaaagcagtctgagtgcgccaccagagtggaaatagtcaggcaaagtttacaaggaagaaacacaaaagttgcagtggttctgattcagaagaaaacccctttgcccccaggagaagatgtcattgcttcagaaagggctgcagctttatgcaatgcatgtgaactctcaggaaagtctttgtttgtactgccgcacactgaccaccttgtgggttatattataagattggaaaatgccttttatgaacatgcacagacttattactacactgagatcagaagagtgaaatctcataaagaatttttgaataaaacaacacaccagcttttatttgttaggcatcagttcaaaatagctttcttcagtgagttgaaacaagatacacaaaatgcgctgaagaattataggaccgcctataatcttgtacacgaattgagagcccatgaaactaatattctggaaattaagactatggcaggatttataaactacaagatctgtaggctgtgttttcaacacaacaccccattggatgcaattgctcagttccgaaaacacatcgacttgtgtaagaaaaagattggaagtgcagagctgtcttttgagcatgatgcatggatgtctaaacaattccaggcctttggagatttatttgatgaagctattaagttagggttaacagctattcaaactcagaatcctggtttctattaccagcaggcagcatactatgcccaggagcggaaacagcttgcaaaaaccctctgtaaccacgaagcttctgtaatgtatcccaatcctgatcccttagaaacacaaacaggcgttcttgacttttatggacaaagatcatggcgacaaggaatactaagttttgatctttctgatcctgaaaaagaaaaggtgggaattcttgccattcagctgaaggagagaaatgttgttcactctgagataatcataactcttctgagcaatgctgttgcacagttcaagaagtataagtgcccgcgaatgaaaagtcacctaatggttcagatgggagaggaatattattacgcaaaggattataccaaagctttgaagttgctggattatgtgatgtgtgattatcggagtgaaggatggtggactctgctcacttctgtattaactacagctctgaagtgctcctacctcatggcccaattaaaggattacattacttactccctagaactccttggtagagcttcaactctgaaagatgaccagaagtctcggatagaaaagaacctcataaatgttttaatgaatgaaagtcctgatccagaacccgactgtgatatcttagctgtgaaaactgctcagaagctgtgggcagaccgaatttctctggctggcagcaatattttcacaataggagtacaggactttgtgccatttgtgcagtgcaaagccaagtttcatgccccaagttttcatgttgatgttcctgttcagtttgatatttatctgaaggctgattgtccacatcccattaggttttccaagctctgtgtcagctttaataatcaggaatacaaccagttctgtgtaatagaagaagcatccaaagcaaatgaagttttagaaaatctgactcaaggaaagatgtgcctagttcctggcaaaacaagaaaactgttatttaagtttgttgcaaaaactgaagatgtgggaaagaaaattgagattacttcagtggatcttgctctgggcaatgagacgggaagatgtgtggttttaaattggcagggaggaggaggagatgctgcttcctcccaagaagccttacaggcagctcggtctttcaaaaggcgacctaagctacctgacaatgaagttcactgggacagcattataattcaggcaagcacaatgatcatatccagagtcccaaacatttctgtacatctgctacatgaaccccctgcactgactaatgaaatgtattgtttggttgtgactgttcagtcccatgaaaagacccaaatcagagatgtgaagctcaccgctggcttaaaaccaggacaggatgccaatttaactcagaagactcacgtgactcttcatggaacagaactgtgtgatgaatcctacccggctttactcactgacattcctgttggagacttacatccaggggaacagctggaaaaaatgttgtatgttcgctgtggaacagtgggttccagaatgtttcttgtatatgtttcttacctgataaatacaaccgttgaagaaaaagaaattgtttgcaagtgtcacaaggatgaaactgtaacaattgaaacagtctttccatttgatgttgcggttaaatttgtttctaccaagtttgagcacctggaaagggtttatgctgacatcccctttctgttgatgacggacctcttaagtgcctcaccctgggccctcactattgtttccagtgagctccagcttgctccatccatgaccacagtggaccagctcgagtctcaagtggacaatgttatcttacagactggagagagtgctagtgaatgcttttgtcttcaatgcccatctcttggaaatattgaaggtggagtagcaaccgggcattatattatctcttggaaaaggacctcagcaatggagaatatccccatcatcacaactgtcatcactctgccgcacgtgattgtggagaatatccctctccatgtgaatgcagatctgccgtcatttgggcgtgtcagagagtcgttacctgtcaagtatcacctacagaataagaccgacttagttcaagatgtagaaatttctgtggagcccagtgatgccttcatgttctcaggtctcaaacagattcgattacgtatcctccctggcacggagcaggaaatgctatataatttctatcctctgatggctggataccagcagctgccatctctcaacatcaacttgcttagatttcctaacttcacaaatcagctgctcaggcgttttatacctaccagtatttttgtcaagccacagggtcgactcatggatgatacctctattgctgctgcatgatgttcaagaccggcccttggctgttgttacagagatgttgggcagagctatgcaggtgtttcattgtgaactctagctttgatcatggtaaaaagttaaccttttctattttttaatggatgttataccaactattcagaggaactcatacttcaaaaatattaggaaaatctgtcttatagtttctctaataaatatctgaaatctcagtacgacatgaaagaatgtcagaccattgttattgttgaaagtcatttgatgaatggtaaattctatgaaaagtaagtgatttgcatgtataatatcaggaaaattaagcatcccaagtgtgactggacaaagagagcagatgcaccagtgcctgtgccataaagttccgaatcccccatgtgtctctttcagagctggccagaccggaaataaatcattctcataaattcagtgtgtactcagaacacatacacaacaacatagggagttgtatgactgatacggaaaacttccagaaagttttaatcaaagcagtttaattaaggtatcaaaaatatctttgcttactatcaagaagtgtcaaataggttcagcttgctgccaaaatatggatcatttatgaagcaggttcatattttagaggtgttaataaaatcctcatcggaaaagatccaaagtgcaaggatttgattataaacataatttcctagactgaaagtttttggaaaagatgcagggtctgagtcaggccttctggttatattgtgcagtttcaaaagaactatttaaaactcttgaaaactcatgtaaataaaaatcatagggtgaaaattgtatttgttaaaataccttaataatttaaaatgacctgatttcctggaaaattttattattcaaaaggtggaggcattgtaaaaaggaaatagtgatgtaaataaacatgttctctttcaagtatgaaaaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:60684 -> Biological process: GO:0016192 [vesicle-mediated transport] evidence: IEA
            GeneID:60684 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.