Home |
Help |
Advanced search
2025-05-09 19:11:22, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_018223 3168 bp mRNA linear PRI 09-JUN-2013
DEFINITION Homo sapiens checkpoint with forkhead and ring finger domains, E3
ubiquitin protein ligase (CHFR), transcript variant 4, mRNA.
ACCESSION NM_018223
VERSION NM_018223.2 GI:239048906
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3168)
AUTHORS Bae,S.J., Kwon,Y.E., Kim,M. and Seol,J.H.
TITLE CHFR is negatively regulated by SUMOylation-mediated ubiquitylation
JOURNAL Biochem. Biophys. Res. Commun. 433 (2), 194-199 (2013)
PUBMED 23454125
REMARK GeneRIF: a new regulatory mechanism for CHFR that sequential
post-translational modifications of CHFR by SUMO and ubiquitin
coordinately regulates its stability
REFERENCE 2 (bases 1 to 3168)
AUTHORS Cal,R., Garcia-Arguinzonis,M., Revuelta-Lopez,E., Castellano,J.,
Padro,T., Badimon,L. and Llorente-Cortes,V.
TITLE Aggregated low-density lipoprotein induces LRP1 stabilization
through E3 ubiquitin ligase CHFR downregulation in human vascular
smooth muscle cells
JOURNAL Arterioscler. Thromb. Vasc. Biol. 33 (2), 369-377 (2013)
PUBMED 23241409
REMARK GeneRIF: Aggregated LDL prolongs the half life of LRP1 by
preventing the receptor ubiquitinylation, at least in part, through
CHFR targeting.
REFERENCE 3 (bases 1 to 3168)
AUTHORS Kwon,Y.E., Bae,S.J., Kim,M. and Seol,J.H.
TITLE SUMOylation negatively regulates the stability of CHFR tumor
suppressor
JOURNAL Biochem. Biophys. Res. Commun. 430 (1), 213-217 (2013)
PUBMED 23131550
REMARK GeneRIF: this study underscores the importance of CHFR SUMOylation
as a new regulatory mechanism of CHFR and highlights the emerging
role of SUMOylation in modulating protein stability.
REFERENCE 4 (bases 1 to 3168)
AUTHORS Li,X., Wang,X., Yang,Y., Xu,C. and Shen,H.
TITLE RNA interference targeting CHFR enhances taxol chemosensitivity in
endometrial cancer cells
JOURNAL Oncol. Rep. 28 (1), 248-254 (2012)
PUBMED 22469813
REMARK GeneRIF: suppression of CHFR induced a significant increase of the
mitotic index and much lower numbers of cells at the G2/M phase in
both cells treated with taxol, indicating mitotic checkpoint
impairment
REFERENCE 5 (bases 1 to 3168)
AUTHORS Kashima,L., Idogawa,M., Mita,H., Shitashige,M., Yamada,T., Ogi,K.,
Suzuki,H., Toyota,M., Ariga,H., Sasaki,Y. and Tokino,T.
TITLE CHFR protein regulates mitotic checkpoint by targeting PARP-1
protein for ubiquitination and degradation
JOURNAL J. Biol. Chem. 287 (16), 12975-12984 (2012)
PUBMED 22337872
REMARK GeneRIF: The interaction between CHFR and PARP-1 plays an important
role in cell cycle regulation and cancer therapeutic strategies.
REFERENCE 6 (bases 1 to 3168)
AUTHORS Stavridi,E.S., Huyen,Y., Loreto,I.R., Scolnick,D.M.,
Halazonetis,T.D., Pavletich,N.P. and Jeffrey,P.D.
TITLE Crystal structure of the FHA domain of the Chfr mitotic checkpoint
protein and its complex with tungstate
JOURNAL Structure 10 (7), 891-899 (2002)
PUBMED 12121644
REFERENCE 7 (bases 1 to 3168)
AUTHORS Mizuno,K., Osada,H., Konishi,H., Tatematsu,Y., Yatabe,Y.,
Mitsudomi,T., Fujii,Y. and Takahashi,T.
TITLE Aberrant hypermethylation of the CHFR prophase checkpoint gene in
human lung cancers
JOURNAL Oncogene 21 (15), 2328-2333 (2002)
PUBMED 11948416
REFERENCE 8 (bases 1 to 3168)
AUTHORS Chaturvedi,P., Sudakin,V., Bobiak,M.L., Fisher,P.W., Mattern,M.R.,
Jablonski,S.A., Hurle,M.R., Zhu,Y., Yen,T.J. and Zhou,B.B.
TITLE Chfr regulates a mitotic stress pathway through its RING-finger
domain with ubiquitin ligase activity
JOURNAL Cancer Res. 62 (6), 1797-1801 (2002)
PUBMED 11912157
REMARK GeneRIF: Chfr regulates a mitotic stress pathway through its
RING-finger domain with ubiquitin ligase activity.
REFERENCE 9 (bases 1 to 3168)
AUTHORS Kang,D., Chen,J., Wong,J. and Fang,G.
TITLE The checkpoint protein Chfr is a ligase that ubiquitinates Plk1 and
inhibits Cdc2 at the G2 to M transition
JOURNAL J. Cell Biol. 156 (2), 249-259 (2002)
PUBMED 11807090
REMARK GeneRIF: checkpoint protein Chfr is a ligase that ubiquitinates
Plk1 and inhibits Cdc2 at the G2 to M transition
REFERENCE 10 (bases 1 to 3168)
AUTHORS Scolnick,D.M. and Halazonetis,T.D.
TITLE Chfr defines a mitotic stress checkpoint that delays entry into
metaphase
JOURNAL Nature 406 (6794), 430-435 (2000)
PUBMED 10935642
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
BP313700.1, AK001658.1, AK027687.1, AC127070.10 and BC012072.1.
On Jun 6, 2009 this sequence version replaced gi:8922674.
Transcript Variant: This variant (4) lacks an in-frame exon and
contains an alternate in-frame exon in the middle portion of the
coding region compared to variant 1. This results in a shorter
protein (isoform 4) compared to isoform 1.
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AK001658.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-20 BP313700.1 1-20
21-727 AK001658.1 1-707
728-728 AK027687.1 809-809
729-1344 AK001658.1 709-1324
1345-1345 AK027687.1 1426-1426
1346-1810 AK001658.1 1326-1790
1811-2113 AK027687.1 1892-2194
2114-2811 AC127070.10 108422-109119
2812-3168 BC012072.1 2825-3181
FEATURES Location/Qualifiers
source 1..3168
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="12"
/map="12q24.33"
gene 1..3168
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/note="checkpoint with forkhead and ring finger domains,
E3 ubiquitin protein ligase"
/db_xref="GeneID:55743"
/db_xref="HGNC:20455"
/db_xref="MIM:605209"
exon 1..72
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/inference="alignment:Splign:1.39.8"
exon 73..217
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/inference="alignment:Splign:1.39.8"
misc_feature 76..78
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/note="upstream in-frame stop codon"
CDS 85..1956
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/note="isoform 4 is encoded by transcript variant 4; RING
finger protein 196; E3 ubiquitin-protein ligase CHFR;
checkpoint with forkhead and RING finger domains protein"
/codon_start=1
/product="E3 ubiquitin-protein ligase CHFR isoform 4"
/protein_id="NP_060693.2"
/db_xref="GI:239048907"
/db_xref="CCDS:CCDS31937.1"
/db_xref="GeneID:55743"
/db_xref="HGNC:20455"
/db_xref="MIM:605209"
/translation="
MERPEEGKQSPPPQPWGRLLRLGAEEGEPHVLLRKREWTIGRRRGCDLSFPSNKLVSGDHCRIVVDEKSGQVTLEDTSTSGTVINKLKVVKKQTCPLQTGDVIYLVYRKNEPEHNVAYLYESLSEKQGMTQESFEMVPCCVAQAGLKLLGSSDPPTLASQSIVITGSGGGGISPKGSGPSVASDEVSSFASALPDRKTASFSSLEPQDQEDLEPVKKKMRGDGDLDLNGQLLVAQPRRNAQTVHEDVRAAAGKPDKMEETLTCIICQDLLHDCVSLQPCMHTFCAACYSGWMERSSLCPTCRCPVERICKNHILNNLVEAYLIQHPDKSRSEEDVQSMDARNKITQDMLQPKVRRSFSDEEGSSEDLLELSDVDSESSDISQPYVVCRQCPEYRRQAAQPPHCPAPEGEPGAPQALGDAPSTSVSLTTAVQDYVCPLQGSHALCTCCFQPMPDRRAEREQDPRVAPQQCAVCLQPFCHLYWGCTRTGCYGCLAPFCELNLGDKCLDGVLNNNSYESDILKNYLATRGLTWKNMLTESLVALQRGVFLLSDYRVTGDTVLCYCCGLRSFRELTYQYRQNIPASELPVAVTSRPDCYWGRNCRTQVKAHHAMKFNHICEQTRFKN
"
misc_feature 130..399
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/note="Forkhead associated domain (FHA); found in
eukaryotic and prokaryotic proteins. Putative nuclear
signalling domain. FHA domains may bind phosphothreonine,
phosphoserine and sometimes phosphotyrosine. In
eukaryotes, many FHA domain-containing proteins...;
Region: FHA; cd00060"
/db_xref="CDD:28942"
misc_feature <175..486
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/note="FOG: FHA domain [Signal transduction mechanisms];
Region: COG1716"
/db_xref="CDD:31902"
misc_feature order(208..210,247..249,253..258,319..327)
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/note="phosphopeptide binding site; other site"
/db_xref="CDD:28942"
misc_feature 865..990
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/note="Zinc finger, C3HC4 type (RING finger); Region:
zf-C3HC4_2; pfam13923"
/db_xref="CDD:206094"
misc_feature 868..999
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/note="RING-finger (Really Interesting New Gene) domain, a
specialized type of Zn-finger of 40 to 60 residues that
binds two atoms of zinc; defined by the 'cross-brace'
motif C-X2-C-X(9-39)-C-X(1-3)-
H-X(2-3)-(N/C/H)-X2-C-X(4-48)C-X2-C; probably involved
in...; Region: RING; cd00162"
/db_xref="CDD:29102"
misc_feature order(871..873,880..882,919..921,925..927,934..936,
943..945,976..978,985..987)
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/note="cross-brace motif; other site"
/db_xref="CDD:29102"
exon 218..317
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/inference="alignment:Splign:1.39.8"
exon 318..427
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/inference="alignment:Splign:1.39.8"
exon 428..487
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/inference="alignment:Splign:1.39.8"
exon 488..580
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/inference="alignment:Splign:1.39.8"
exon 581..748
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/inference="alignment:Splign:1.39.8"
variation 604
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/replace="c"
/replace="t"
/db_xref="dbSNP:34220055"
variation 661
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/replace="c"
/replace="t"
/db_xref="dbSNP:35206714"
exon 749..908
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/inference="alignment:Splign:1.39.8"
variation 846
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/replace="a"
/replace="c"
/db_xref="dbSNP:35011845"
exon 909..1063
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/inference="alignment:Splign:1.39.8"
exon 1064..1226
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/inference="alignment:Splign:1.39.8"
exon 1227..1369
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/inference="alignment:Splign:1.39.8"
exon 1370..1489
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/inference="alignment:Splign:1.39.8"
exon 1490..1573
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/inference="alignment:Splign:1.39.8"
exon 1574..1644
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/inference="alignment:Splign:1.39.8"
exon 1645..1732
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/inference="alignment:Splign:1.39.8"
exon 1733..1840
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/inference="alignment:Splign:1.39.8"
exon 1841..1913
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/inference="alignment:Splign:1.39.8"
exon 1914..3158
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/inference="alignment:Splign:1.39.8"
variation 2027
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/replace="a"
/replace="g"
/db_xref="dbSNP:1045979"
STS 2246..2428
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/standard_name="RH98685"
/db_xref="UniSTS:83815"
variation 2811
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/replace="a"
/replace="g"
/db_xref="dbSNP:8021"
variation 3036
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/replace="c"
/replace="t"
/db_xref="dbSNP:1046106"
variation 3132
/gene="CHFR"
/gene_synonym="RNF116; RNF196"
/replace="c"
/replace="t"
/db_xref="dbSNP:1046130"
ORIGIN
agctgagggagccgcaatgtctcttgacagcggcggcggcgcagccggttccgggttcggcgcggggcggggatgtgaatcccgatggagcggcccgaggaaggcaagcagtcgccgccgccgcagccctggggacggctcctgcgtctgggcgcggaggagggcgagccgcacgtcctcctgaggaagcgggagtggaccatcgggcggagacgaggttgcgacctttccttccccagcaataaactggtctctggagatcactgtagaattgtagtggatgaaaaatcaggtcaggtgacactggaagataccagcaccagtggaacagtgattaacaagctgaaggttgttaagaagcagacatgccctttacagactggggatgtcatctacttggtgtacaggaagaatgaaccggaacacaacgtggcatacctctatgaatctttaagtgaaaagcaaggcatgacacaagaatcctttgagatggtgccttgctgtgttgcccaggctggtctaaaactcctgggatcaagtgatcctcccaccttggcctcccaaagtattgtgattacagggtctgggggtggtggcatctcccctaaaggaagtggtccctctgtggcaagtgatgaagtctccagctttgcctcagctctcccagacagaaagactgcgtccttttcgtcgttggaaccccaggatcaggaggatttggagcccgtgaagaagaaaatgagaggagatggggaccttgacctgaacgggcagttgttggtcgcacaaccgcgtagaaatgcccaaaccgtccacgaggacgtcagagcagcggctgggaagccagacaagatggaggagacgctgacatgcatcatctgccaggacctgctgcacgactgcgtgagtttgcagccctgcatgcacacgttctgcgcggcttgctactcgggctggatggagcgctcgtccctgtgtcctacctgccgctgtcccgtggagcggatctgtaaaaaccacatcctcaacaacctcgtggaagcatacctcatccagcatccagacaagagtcgcagtgaagaagatgtgcaaagtatggatgccaggaataaaatcactcaagacatgctgcagcccaaagtcaggcggtctttttctgatgaagaagggagttcagaggacctgctggagctgtcagacgttgacagtgagtcctcagacattagccagccatacgtcgtgtgccggcagtgtcctgagtacagaaggcaggcggcgcagcctccccactgcccagcacccgagggcgagccaggagccccacaggccctgggggatgcaccctccacgtccgtcagcctgacgacagcagtccaggattacgtgtgccctctgcaaggaagccacgccctgtgcacctgctgcttccagcccatgcccgaccggagagcggagcgcgagcaggacccgcgtgtcgcccctcagcagtgtgcggtctgcctgcagcctttctgccacctgtactggggctgcacccggaccggctgctacggctgcctggccccgttttgtgagctcaacctgggtgacaagtgtctggacggcgtgctgaacaacaacagctacgagtcagacatcctgaagaattacctggcaaccagaggtttgacatggaaaaacatgttgaccgagagcctcgtggctctccagcggggagtgtttctgctgtctgattacagagtcacgggagacaccgttctgtgttactgctgtggcctgcgcagcttccgtgagctgacctatcagtatcggcagaacattcctgcttccgagttgccagtggccgtaacatcccgtcctgactgctactggggccgtaactgccgcactcaggtgaaagctcaccacgccatgaaattcaatcatatctgtgaacagacaaggttcaaaaactaagcatccagaggccctgagcagctttcagcactggaggtgaagagagcgtgtttttaaaatacagagacaagcacgtcaaggtgttttcacagccccctgagggaagggacgcagggtctccgacaggtgctctggggtgactcttctgtggagctttaccctctgagtgagaccctccccagagccccgggggccgcagcccgccctcctggtgagcgctgggcagggctcgtggtggcatcagcagcagagacgaagcctttctgtaacatgcggccgtcccgccgagaggggcagttttgctcttttgtacattttccgaaactacagttaaagcagaagtctgtttttaggaaaagtttcaagggagaagggcaagtttatcaaaaacattgtttcaggagaagggagcataagtttacagcctacaggacgtacacaatatcctgctgctgggaaaaccacagcattttatctattttttattttaataggtttggtgcttatcttctaataagatttaaatgtcacaaactgtagcacaaataatataatttataatttacaaattgactaaaattgggtatagtatggtatttgaaagaataagcatatgcttctgtttattaaaaaaagaaaccttccaatgtccaaaactgctaaccctcgacgtggccgccaagttagtcgctccttgctaaccggtgagtgaccgcggccccgagcctggggctggacgcaggtcccaggacatgctgctcccttgtgtgagtgaccgcggccccgagcctggggctggacgcaggtcccaggacgtgctgctcccttgtgtgagtgaccacggccccaagcccagggctggaggcaggtcccaggacgcgccgctccctcatgctgcccgggcccttcctccaagaccctacagagcctgaggggcaccttggcttccgcctgtgctagctttgccatgtcatctggaataatacttgaaattttgatttttggaaaaaaaagttttttatcttttgttgaaatcacctgttatccttgtttgtaaactgataacttttttgcttcttctcaggaatacagttttcaactgttgtcttgctcttgatagaaactgagaagcagcaatctgtatttgtggaggaaagtcctctcttttgcatattctaataaatgagccgcgtttgctcctcaaaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:55743 -> Molecular function: GO:0000166 [nucleotide binding] evidence: IDA
GeneID:55743 -> Molecular function: GO:0004842 [ubiquitin-protein ligase activity] evidence: IDA
GeneID:55743 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:55743 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IEA
GeneID:55743 -> Biological process: GO:0000209 [protein polyubiquitination] evidence: IDA
GeneID:55743 -> Biological process: GO:0006511 [ubiquitin-dependent protein catabolic process] evidence: IEA
GeneID:55743 -> Biological process: GO:0007067 [mitosis] evidence: IEA
GeneID:55743 -> Biological process: GO:0007093 [mitotic cell cycle checkpoint] evidence: IMP
GeneID:55743 -> Biological process: GO:0007093 [mitotic cell cycle checkpoint] evidence: TAS
GeneID:55743 -> Biological process: GO:0019941 [modification-dependent protein catabolic process] evidence: IDA
GeneID:55743 -> Biological process: GO:0051301 [cell division] evidence: IEA
GeneID:55743 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:55743 -> Cellular component: GO:0016605 [PML body] evidence: IDA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_060693 -> EC 6.3.2.-
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.