Home |
Help |
Advanced search
2025-05-09 19:32:38, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_006756 2784 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens transcription elongation factor A (SII), 1 (TCEA1),
transcript variant 1, mRNA.
ACCESSION NM_006756 XM_001127192
VERSION NM_006756.2 GI:45439353
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2784)
AUTHORS Shema,E., Kim,J., Roeder,R.G. and Oren,M.
TITLE RNF20 inhibits TFIIS-facilitated transcriptional elongation to
suppress pro-oncogenic gene expression
JOURNAL Mol. Cell 42 (4), 477-488 (2011)
PUBMED 21596312
REMARK GeneRIF: RNF20, presumably via H2Bub, selectively represses
oncogenic genes by interfering with chromatin recruitment of TFIIS,
a factor capable of relieving stalled RNA polymerase II. RNF20
inhibits the interaction between TFIIS and the PAF1 complex.
REFERENCE 2 (bases 1 to 2784)
AUTHORS Mackinnon-Roy,C., Stubbert,L.J. and McKay,B.C.
TITLE RNA interference against transcription elongation factor SII does
not support its role in transcription-coupled nucleotide excision
repair
JOURNAL Mutat. Res. 706 (1-2), 53-58 (2011)
PUBMED 21070792
REMARK GeneRIF: Results indicate that TFIIS is not limiting for the repair
of transcription-blocking DNA lesions and thus the present work
does not support a role for TFIIS in TC-NER.
REFERENCE 3 (bases 1 to 2784)
AUTHORS Jensen,A. and Mullenders,L.H.
TITLE Transcription factor IIS impacts UV-inhibited transcription
JOURNAL DNA Repair (Amst.) 9 (11), 1142-1150 (2010)
PUBMED 20729154
REMARK GeneRIF: a role for TFIIS in transcription recovery and
re-establishment of the balance between hypo- and
hyper-phosphorylated RNAPII after DNA damage repair
REFERENCE 4 (bases 1 to 2784)
AUTHORS Asp,J., Persson,F., Kost-Alimova,M. and Stenman,G.
TITLE CHCHD7-PLAG1 and TCEA1-PLAG1 gene fusions resulting from cryptic,
intrachromosomal 8q rearrangements in pleomorphic salivary gland
adenomas
JOURNAL Genes Chromosomes Cancer 45 (9), 820-828 (2006)
PUBMED 16736500
REMARK GeneRIF: PLAG1 protein is overexpressed in epithelial,
myoepithelial, and mesenchymal-like tumor cells in tumors with
fusions to CHCHD7 and TCEA1.
REFERENCE 5 (bases 1 to 2784)
AUTHORS Ling,Y., Smith,A.J. and Morgan,G.T.
TITLE A sequence motif conserved in diverse nuclear proteins identifies a
protein interaction domain utilised for nuclear targeting by human
TFIIS
JOURNAL Nucleic Acids Res. 34 (8), 2219-2229 (2006)
PUBMED 16648364
REMARK Publication Status: Online-Only
REFERENCE 6 (bases 1 to 2784)
AUTHORS Qian,X., Jeon,C., Yoon,H., Agarwal,K. and Weiss,M.A.
TITLE Structure of a new nucleic-acid-binding motif in eukaryotic
transcriptional elongation factor TFIIS
JOURNAL Nature 365 (6443), 277-279 (1993)
PUBMED 7626141
REMARK Erratum:[Nature 1995 Jul 20;376(6537):279]
REFERENCE 7 (bases 1 to 2784)
AUTHORS Chen,H.C., England,L. and Kane,C.M.
TITLE Characterization of a HeLa cDNA clone encoding the human SII
protein, an elongation factor for RNA polymerase II
JOURNAL Gene 116 (2), 253-258 (1992)
PUBMED 1378807
REFERENCE 8 (bases 1 to 2784)
AUTHORS Kato,H., Sumimoto,H., Pognonec,P., Chen,C.H., Rosen,C.A. and
Roeder,R.G.
TITLE HIV-1 Tat acts as a processivity factor in vitro in conjunction
with cellular elongation factors
JOURNAL Genes Dev. 6 (4), 655-666 (1992)
PUBMED 1559613
REFERENCE 9 (bases 1 to 2784)
AUTHORS Yoo,O.J., Yoon,H.S., Baek,K.H., Jeon,C.J., Miyamoto,K., Ueno,A. and
Agarwal,K.
TITLE Cloning, expression and characterization of the human transcription
elongation factor, TFIIS
JOURNAL Nucleic Acids Res. 19 (5), 1073-1079 (1991)
PUBMED 1708494
REFERENCE 10 (bases 1 to 2784)
AUTHORS Reines,D., Chamberlin,M.J. and Kane,C.M.
TITLE Transcription elongation factor SII (TFIIS) enables RNA polymerase
II to elongate through a block to transcription in a human gene in
vitro
JOURNAL J. Biol. Chem. 264 (18), 10799-10809 (1989)
PUBMED 2471707
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AU280634.1, BM477937.1, X62585.1, BX538034.1 and M81601.1.
On or before Sep 20, 2006 this sequence version replaced
gi:113420401, gi:5803190.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: M81601.1, BC072460.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-157 AU280634.1 1-157
158-643 BM477937.1 122-607
644-2653 X62585.1 425-2434
2654-2769 BX538034.1 2849-2964
2770-2782 X62585.1 2550-2562
2783-2784 M81601.1 2633-2634
FEATURES Location/Qualifiers
source 1..2784
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="8"
/map="8q11.2"
gene 1..2784
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/note="transcription elongation factor A (SII), 1"
/db_xref="GeneID:6917"
/db_xref="HGNC:11612"
/db_xref="HPRD:03252"
/db_xref="MIM:601425"
exon 1..386
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/inference="alignment:Splign:1.39.8"
misc_feature 24..26
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/note="upstream in-frame stop codon"
CDS 324..1229
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/note="isoform 1 is encoded by transcript variant 1;
transcription elongation factor A protein 1; transcription
elongation factor TFIIS.o; transcription elongation factor
S-II protein 1"
/codon_start=1
/product="transcription elongation factor A protein 1
isoform 1"
/protein_id="NP_006747.1"
/db_xref="GI:5803191"
/db_xref="CCDS:CCDS47858.1"
/db_xref="GeneID:6917"
/db_xref="HGNC:11612"
/db_xref="HPRD:03252"
/db_xref="MIM:601425"
/translation="
MEDEVVRFAKKMDKMVQKKNAAGALDLLKELKNIPMTLELLQSTRIGMSVNAIRKQSTDEEVTSLAKSLIKSWKKLLDGPSTEKDLDEKKKEPAITSQNSPEAREESTSSGNVSNRKDETNARDTYVSSFPRAPSTSDSVRLKCREMLAAALRTGDDYIAIGADEEELGSQIEEAIYQEIRNTDMKYKNRVRSRISNLKDAKNPNLRKNVLCGNIPPDLFARMTAEEMASDELKEMRKNLTKEAIREHQMAKTGGTQTDLFTCGKCKKKNCTYTQVQTRSADEPMTTFVVCNECGNRWKFC
"
misc_feature 324..326
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/experiment="experimental evidence, no additional details
recorded"
/note="N-acetylmethionine; propagated from
UniProtKB/Swiss-Prot (P23193.2); acetylation site"
misc_feature 327..557
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/note="N-terminal domain (domain I) of transcription
elongation factor S-II (TFIIS); similar to a domain found
in elongin A and CRSP70; likely to be involved in
transcription; domain I from TFIIS interacts with RNA
polymerase II holoenzyme; Region: TFIIS_I; cd00183"
/db_xref="CDD:29145"
misc_feature 333..1226
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/note="transcription elongation factor S-II; Region:
TFSII; TIGR01385"
/db_xref="CDD:213613"
misc_feature order(351..356,363..365,483..488)
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/note="putative RNA polymerase binding site [polypeptide
binding]; other site"
/db_xref="CDD:29145"
misc_feature 612..614
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P23193.2); phosphorylation site"
misc_feature 612..614
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 621..623
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P23193.2); phosphorylation site"
misc_feature 621..623
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 621..623
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 648..650
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 729..1073
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/note="Transcription factor S-II (TFIIS), central domain;
Region: TFIIS_M; pfam07500"
/db_xref="CDD:203654"
misc_feature 1104..1220
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/note="Transcription factor S-II (TFIIS); Region: TFIIS_C;
pfam01096"
/db_xref="CDD:201594"
exon 387..449
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/inference="alignment:Splign:1.39.8"
exon 450..555
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/inference="alignment:Splign:1.39.8"
exon 556..643
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/inference="alignment:Splign:1.39.8"
exon 644..789
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/inference="alignment:Splign:1.39.8"
exon 790..846
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/inference="alignment:Splign:1.39.8"
exon 847..1001
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/inference="alignment:Splign:1.39.8"
exon 1002..1148
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/inference="alignment:Splign:1.39.8"
STS 1062..2013
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/standard_name="D3S4495"
/db_xref="UniSTS:474550"
exon 1149..1220
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/inference="alignment:Splign:1.39.8"
exon 1221..2777
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/inference="alignment:Splign:1.39.8"
STS 1293..1389
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/standard_name="D8S2054"
/db_xref="UniSTS:62475"
variation 1425
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/replace="g"
/replace="t"
/db_xref="dbSNP:1050471"
variation 1822
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/replace="a"
/replace="g"
/db_xref="dbSNP:11550741"
variation 1857
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/replace="a"
/replace="t"
/db_xref="dbSNP:11550739"
STS 2505..2625
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/standard_name="RH66562"
/db_xref="UniSTS:91733"
variation 2610
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
/replace="a"
/replace="g"
/db_xref="dbSNP:1050523"
polyA_signal 2750..2755
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
polyA_site 2777
/gene="TCEA1"
/gene_synonym="GTF2S; SII; TCEA; TF2S; TFIIS"
ORIGIN
agccggaagccacgcctgcccactagcccgacgcccgcctggcgggaacatgggctcgcccctcaccagcgatctgcagtcagttggtagcgcctgcacgtcgcgcgcggtgttcgattgtcgctgcctggggaggaggagccggagccgccgccgccgccgccgccgccgcgggcttcgttcgtaaggaagggggcctaggcccgggcctgcggtggtgggggttgctgcgcgccgggggtcgctcctgctgtgtcttccgctccagcttcgcccacttccccttgccagcggggtgggcgcggagaagacctgccggagccatggaggacgaagtggtccgctttgccaagaagatggacaagatggtgcagaagaagaacgcggctggagcattggatttgctaaaggagcttaagaatattcctatgaccctggaattactgcagtccacaagaatcggaatgtcagttaatgctattcgcaagcagagtacagatgaggaagttacatctttggcaaagtctctcatcaaatcctggaaaaaattattagatgggccatcaactgagaaagaccttgacgaaaagaagaaagaacctgcaattacatcgcagaacagccctgaggcaagagaagaaagtacttccagcggcaatgtaagcaacagaaaggatgagacaaatgctcgagatacttatgtttcatcctttcctcgggcaccaagcacttctgattctgtgcggttgaagtgtagggagatgcttgctgcagctcttcgaacaggggatgactacattgcaattggagctgatgaggaagaattaggatctcaaattgaagaagctatatatcaagaaataaggaatacagacatgaaatacaaaaatagagtacgaagtaggatatcaaatcttaaagatgcaaaaaatccaaatttaaggaaaaatgtcctctgtgggaatattcctcctgacttatttgctagaatgacagcagaggaaatggctagtgatgagctgaaagagatgcggaaaaacttgaccaaagaagccatcagagagcatcagatggccaagactggtgggacccagactgacttgttcacatgtggcaaatgtaaaaagaagaattgcacttacacacaggtacaaacccgtagtgctgatgaaccaatgacaacatttgttgtctgtaatgaatgtggaaatcgatggaagttctgttgagttggaagaattggcaaaatatctggaccattaagaaaacggattttgtaactagctttaaactaggccaagcaactagttttcctgcaaatcaaatttttaaagcaacttgggttagactttgtttttgacctaacatcccttccttaaatgccttctgtagtttcagatcagtagggagaccatataataattttatggtacctgtttcaaaacatattttttctgtttttataagtaagttgatattaattaaactcttggcaatatttcttctttcttaaaggaaaatataccttaactttttttcttttacactgtgaaacatacacagtagaaattctgttactctctgttattaatacataaatgaaaatacatttttttccatattggcatgtagctacaaatattaaaggaggagaaaaggtaatataattttaggtttaccaaatatggtgtgtattcaaataatacttgaccagcttatctaaaatgtacataattttgaggtagcttatgaatttgattttaattattatgttcacaagcttggaatattagatattattttgcatctgtaactaaccgtgatcatcatttcttgtaatttcttgtacatgtatattacttgttcttaatagatttttggaaacaagactttattgagatcagtttggttttcctgttaatttacctgtttgactttataatgtgttttagttttgcagaagaacactgttgtagtttagaaggcttttcataaatcccctcataggcaaagatgaaaacttcccactatttttttcccctcttaggaagacatactggaaagaaaatgtttagcatcttagtgtagtatagctattgtaaacagttcatgactagattttgattcggaaatctatactgaccaaggattaatcttaaggattgtataattcattaaagctgtggtctttccatgtggagactgatagaaaataattttgtcccaagtcttatttgctgactttttctgtcatgagtgagattgttgaacaaactgaatatatgggctatagcaagtagctttacagtacagatcttacaattaagttttgcttttgttaaagtgtgtaccattttttctgtttggagtaagacaaaaattgttttgacataggttccctagggtacacttgctctagcatactttaaaggccactgttgcaaagtctacattttatgctgaatctgcattctgtcaggcacccgtagaaagacctcagtacatgctttgcactctcctttgctccctttttccaatttcttattgcatatcattttgttgtaatacagaaagcagcatttttaaatgtccgtgttaagaattggcccactggtaccaactcacctctattttgtcagttcatagttgaagattttgttttatttcaaaaacaaagtacatttttgaaataatgtttcagaataaaataatctcacttttaagtgatccattttaaaatttgtaattcaataaagttttttttgttgttaaacataaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:6917 -> Molecular function: GO:0003677 [DNA binding] evidence: IEA
GeneID:6917 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:6917 -> Molecular function: GO:0008270 [zinc ion binding] evidence: IEA
GeneID:6917 -> Biological process: GO:0006281 [DNA repair] evidence: TAS
GeneID:6917 -> Biological process: GO:0006283 [transcription-coupled nucleotide-excision repair] evidence: TAS
GeneID:6917 -> Biological process: GO:0006289 [nucleotide-excision repair] evidence: TAS
GeneID:6917 -> Biological process: GO:0006366 [transcription from RNA polymerase II promoter] evidence: TAS
GeneID:6917 -> Biological process: GO:0006368 [transcription elongation from RNA polymerase II promoter] evidence: TAS
GeneID:6917 -> Biological process: GO:0010467 [gene expression] evidence: TAS
GeneID:6917 -> Biological process: GO:0016032 [viral process] evidence: TAS
GeneID:6917 -> Biological process: GO:0030218 [erythrocyte differentiation] evidence: IEA
GeneID:6917 -> Biological process: GO:0032784 [regulation of DNA-dependent transcription, elongation] evidence: IEA
GeneID:6917 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IEA
GeneID:6917 -> Biological process: GO:0050434 [positive regulation of viral transcription] evidence: TAS
GeneID:6917 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:6917 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
GeneID:6917 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.