Home |
Help |
Advanced search
2025-05-09 19:27:34, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_004456 2723 bp mRNA linear PRI 07-JUL-2013
DEFINITION Homo sapiens enhancer of zeste homolog 2 (Drosophila) (EZH2),
transcript variant 1, mRNA.
ACCESSION NM_004456
VERSION NM_004456.4 GI:322506095
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2723)
AUTHORS Luo,M., Li,Z., Wang,W., Zeng,Y., Liu,Z. and Qiu,J.
TITLE Long non-coding RNA H19 increases bladder cancer metastasis by
associating with EZH2 and inhibiting E-cadherin expression
JOURNAL Cancer Lett. 333 (2), 213-221 (2013)
PUBMED 23354591
REMARK GeneRIF: Long non-coding RNA H19 is associated with enhancer of
zeste homolog 2 (EZH2)
REFERENCE 2 (bases 1 to 2723)
AUTHORS Zhang,Y., Liu,G., Lin,C., Liao,G. and Tang,B.
TITLE Silencing the EZH2 gene by RNA interference reverses the drug
resistance of human hepatic multidrug-resistant cancer cells to
5-Fu
JOURNAL Life Sci. 92 (17-19), 896-902 (2013)
PUBMED 23562851
REMARK GeneRIF: EZH2 is highly expressed in the human hepatic
multidrug-resistant cancer cell line Bel/Fu
REFERENCE 3 (bases 1 to 2723)
AUTHORS Li,C.H., To,K.F., Tong,J.H., Xiao,Z., Xia,T., Lai,P.B., Chow,S.C.,
Zhu,Y.X., Chan,S.L., Marquez,V.E. and Chen,Y.
TITLE Enhancer of zeste homolog 2 silences microRNA-218 in human
pancreatic ductal adenocarcinoma cells by inducing formation of
heterochromatin
JOURNAL Gastroenterology 144 (5), 1086-1097 (2013)
PUBMED 23395645
REMARK GeneRIF: EZH2 is up-regulated in PDAC samples from patients and
silences miR-218. MicroRNA-218 prevents proliferation of PDAC cells
in culture, and tumor growth and metastasis in nude mice.
REFERENCE 4 (bases 1 to 2723)
AUTHORS Wang,J., Yu,L., Cai,J., Jia,J., Gao,Y., Liang,M. and Wang,Z.
TITLE The role of EZH2 and DNA methylation in hMLH1 silencing in
epithelial ovarian cancer
JOURNAL Biochem. Biophys. Res. Commun. 433 (4), 470-476 (2013)
PUBMED 23523787
REMARK GeneRIF: EZH2 can modulate the transcription of basally expressed
hMLH1 (human mutL homolog 1 gene) via a
non-DNA-methylation-dependent pathway, but it has no effect on
hMLH1 silencing that is mediated by DNA hypermethylation.
REFERENCE 5 (bases 1 to 2723)
AUTHORS Cao,W., Ribeiro Rde,O., Liu,D., Saintigny,P., Xia,R., Xue,Y.,
Lin,R., Mao,L. and Ren,H.
TITLE EZH2 promotes malignant behaviors via cell cycle dysregulation and
its mRNA level associates with prognosis of patient with non-small
cell lung cancer
JOURNAL PLoS ONE 7 (12), E52984 (2012)
PUBMED 23300840
REMARK GeneRIF: EZH2 mRNA levels may serve as a prognostic predictor for
patients with non-small cell lung cancer.
REFERENCE 6 (bases 1 to 2723)
AUTHORS Cardoso,C., Timsit,S., Villard,L., Khrestchatisky,M., Fontes,M. and
Colleaux,L.
TITLE Specific interaction between the XNP/ATR-X gene product and the SET
domain of the human EZH2 protein
JOURNAL Hum. Mol. Genet. 7 (4), 679-684 (1998)
PUBMED 9499421
REFERENCE 7 (bases 1 to 2723)
AUTHORS Laible,G., Wolf,A., Dorn,R., Reuter,G., Nislow,C., Lebersorger,A.,
Popkin,D., Pillus,L. and Jenuwein,T.
TITLE Mammalian homologues of the Polycomb-group gene Enhancer of zeste
mediate gene silencing in Drosophila heterochromatin and at S.
cerevisiae telomeres
JOURNAL EMBO J. 16 (11), 3219-3232 (1997)
PUBMED 9214638
REFERENCE 8 (bases 1 to 2723)
AUTHORS Chen,H., Rossier,C. and Antonarakis,S.E.
TITLE Cloning of a human homolog of the Drosophila enhancer of zeste gene
(EZH2) that maps to chromosome 21q22.2
JOURNAL Genomics 38 (1), 30-37 (1996)
PUBMED 8954776
REFERENCE 9 (bases 1 to 2723)
AUTHORS Abel,K.J., Brody,L.C., Valdes,J.M., Erdos,M.R., McKinley,D.R.,
Castilla,L.H., Merajver,S.D., Couch,F.J., Friedman,L.S.,
Ostermeyer,E.A., Lynch,E.D., King,M.C., Welcsh,P.L.,
Osborne-Lawrence,S., Spillman,M., Bowcock,A.M., Collins,F.S. and
Weber,B.L.
TITLE Characterization of EZH1, a human homolog of Drosophila Enhancer of
zeste near BRCA1
JOURNAL Genomics 37 (2), 161-171 (1996)
PUBMED 8921387
REFERENCE 10 (bases 1 to 2723)
AUTHORS Hobert,O., Jallal,B. and Ullrich,A.
TITLE Interaction of Vav with ENX-1, a putative transcriptional regulator
of homeobox gene expression
JOURNAL Mol. Cell. Biol. 16 (6), 3066-3073 (1996)
PUBMED 8649418
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from CN283479.1, BC010858.2 and
BU953788.1.
This sequence is a reference standard in the RefSeqGene project.
On Feb 8, 2011 this sequence version replaced gi:23510382.
Summary: This gene encodes a member of the Polycomb-group (PcG)
family. PcG family members form multimeric protein complexes, which
are involved in maintaining the transcriptional repressive state of
genes over successive cell generations. This protein associates
with the embryonic ectoderm development protein, the VAV1
oncoprotein, and the X-linked nuclear protein. This protein may
play a role in the hematopoietic and central nervous systems.
Multiple alternatively splcied transcript variants encoding
distinct isoforms have been identified for this gene. [provided by
RefSeq, Feb 2011].
Transcript Variant: This variant (1) encodes the longest isoform
(a).
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC010858.2 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-71 CN283479.1 1-71
72-2710 BC010858.2 1-2639
2711-2723 BU953788.1 491-503
FEATURES Location/Qualifiers
source 1..2723
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="7"
/map="7q35-q36"
gene 1..2723
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/note="enhancer of zeste homolog 2 (Drosophila)"
/db_xref="GeneID:2146"
/db_xref="HGNC:3527"
/db_xref="HPRD:03342"
/db_xref="MIM:601573"
exon 1..186
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/inference="alignment:Splign:1.39.8"
misc_feature 32..34
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/note="upstream in-frame stop codon"
exon 187..310
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/inference="alignment:Splign:1.39.8"
CDS 194..2449
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/EC_number="2.1.1.43"
/note="isoform a is encoded by transcript variant 1;
lysine N-methyltransferase 6; histone-lysine
N-methyltransferase EZH2"
/codon_start=1
/product="histone-lysine N-methyltransferase EZH2 isoform
a"
/protein_id="NP_004447.2"
/db_xref="GI:21361095"
/db_xref="CCDS:CCDS5891.1"
/db_xref="GeneID:2146"
/db_xref="HGNC:3527"
/db_xref="HPRD:03342"
/db_xref="MIM:601573"
/translation="
MGQTGKKSEKGPVCWRKRVKSEYMRLRQLKRFRRADEVKSMFSSNRQKILERTEILNQEWKQRRIQPVHILTSVSSLRGTRECSVTSDLDFPTQVIPLKTLNAVASVPIMYSWSPLQQNFMVEDETVLHNIPYMGDEVLDQDGTFIEELIKNYDGKVHGDRECGFINDEIFVELVNALGQYNDDDDDDDGDDPEEREEKQKDLEDHRDDKESRPPRKFPSDKIFEAISSMFPDKGTAEELKEKYKELTEQQLPGALPPECTPNIDGPNAKSVQREQSLHSFHTLFCRRCFKYDCFLHRKCNYSFHATPNTYKRKNTETALDNKPCGPQCYQHLEGAKEFAAALTAERIKTPPKRPGGRRRGRLPNNSSRPSTPTINVLESKDTDSDREAGTETGGENNDKEEEEKKDETSSSSEANSRCQTPIKMKPNIEPPENVEWSGAEASMFRVLIGTYYDNFCAIARLIGTKTCRQVYEFRVKESSIIAPAPAEDVDTPPRKKKRKHRLWAAHCRKIQLKKDGSSNHVYNYQPCDHPRQPCDSSCPCVIAQNFCEKFCQCSSECQNRFPGCRCKAQCNTKQCPCYLAVRECDPDLCLTCGAADHWDSKNVSCKNCSIQRGSKKHLLLAPSDVAGWGIFIKDPVQKNEFISEYCGEIISQDEADRRGKVYDKYMCSFLFNLNNDFVVDATRKGNKIRFANHSVNPNCYAKVMMVNGDHRIGIFAKRAIQTGEELFFDYRYSQADALKYVGIEREMEIP
"
misc_feature 254..256
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine, by PKB/AKT1; propagated from
UniProtKB/Swiss-Prot (Q15910.2); phosphorylation site"
misc_feature 254..256
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:01261"
misc_feature 308..397
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/note="WD repeat binding protein EZH2; Region:
EZH2_WD-Binding; pfam11616"
/db_xref="CDD:204691"
misc_feature 308..397
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q15910.2);
Region: Interaction with EED (By similarity)"
misc_feature 1241..1243
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine, by CDK1 and CDK2; propagated from
UniProtKB/Swiss-Prot (Q15910.2); phosphorylation site"
misc_feature 1304..1306
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(Q15910.2); phosphorylation site"
misc_feature 1307..1309
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (Q15910.2); phosphorylation site"
misc_feature 1667..1669
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (Q15910.2); phosphorylation site"
misc_feature 1667..1669
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1667..1669
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 2042..2407
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/note="SET (Su(var)3-9, Enhancer-of-zeste, Trithorax)
domain; Region: SET; smart00317"
/db_xref="CDD:197649"
exon 311..439
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/inference="alignment:Splign:1.39.8"
exon 440..556
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/inference="alignment:Splign:1.39.8"
exon 557..677
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/inference="alignment:Splign:1.39.8"
exon 678..818
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/inference="alignment:Splign:1.39.8"
exon 819..921
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/inference="alignment:Splign:1.39.8"
exon 922..1100
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/inference="alignment:Splign:1.39.8"
variation 946
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/replace="a"
/replace="g"
/db_xref="dbSNP:11541109"
exon 1101..1192
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/inference="alignment:Splign:1.39.8"
exon 1193..1433
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/inference="alignment:Splign:1.39.8"
exon 1434..1603
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/inference="alignment:Splign:1.39.8"
exon 1604..1698
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/inference="alignment:Splign:1.39.8"
exon 1699..1739
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/inference="alignment:Splign:1.39.8"
exon 1740..1865
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/inference="alignment:Splign:1.39.8"
exon 1866..2044
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/inference="alignment:Splign:1.39.8"
exon 2045..2140
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/inference="alignment:Splign:1.39.8"
exon 2141..2222
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/inference="alignment:Splign:1.39.8"
exon 2223..2303
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/inference="alignment:Splign:1.39.8"
exon 2304..2388
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/inference="alignment:Splign:1.39.8"
exon 2389..2723
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/inference="alignment:Splign:1.39.8"
variation 2470
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/replace=""
/replace="c"
/db_xref="dbSNP:3217095"
variation 2470
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/replace="c"
/replace="t"
/db_xref="dbSNP:201597962"
variation 2533
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/replace="a"
/replace="g"
/db_xref="dbSNP:11541108"
variation 2569
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
/replace="g"
/replace="t"
/db_xref="dbSNP:8829"
polyA_signal 2690..2695
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
polyA_site 2721
/gene="EZH2"
/gene_synonym="ENX-1; ENX1; EZH1; KMT6; KMT6A; WVS; WVS2"
ORIGIN
ggcggcgcttgattgggctgggggggccaaataaaagcgatggcgattgggctgccgcgtttggcgctcggtccggtcgcgtccgacacccggtgggactcagaaggcagtggagccccggcggcggcggcggcggcgcgcgggggcgacgcgcgggaacaacgcgagtcggcgcgcgggacgaagaataatcatgggccagactgggaagaaatctgagaagggaccagtttgttggcggaagcgtgtaaaatcagagtacatgcgactgagacagctcaagaggttcagacgagctgatgaagtaaagagtatgtttagttccaatcgtcagaaaattttggaaagaacggaaatcttaaaccaagaatggaaacagcgaaggatacagcctgtgcacatcctgacttctgtgagctcattgcgcgggactagggagtgttcggtgaccagtgacttggattttccaacacaagtcatcccattaaagactctgaatgcagttgcttcagtacccataatgtattcttggtctcccctacagcagaattttatggtggaagatgaaactgttttacataacattccttatatgggagatgaagttttagatcaggatggtactttcattgaagaactaataaaaaattatgatgggaaagtacacggggatagagaatgtgggtttataaatgatgaaatttttgtggagttggtgaatgcccttggtcaatataatgatgatgacgatgatgatgatggagacgatcctgaagaaagagaagaaaagcagaaagatctggaggatcaccgagatgataaagaaagccgcccacctcggaaatttccttctgataaaatttttgaagccatttcctcaatgtttccagataagggcacagcagaagaactaaaggaaaaatataaagaactcaccgaacagcagctcccaggcgcacttcctcctgaatgtacccccaacatagatggaccaaatgctaaatctgttcagagagagcaaagcttacactcctttcatacgcttttctgtaggcgatgttttaaatatgactgcttcctacatcgtaagtgcaattattcttttcatgcaacacccaacacttataagcggaagaacacagaaacagctctagacaacaaaccttgtggaccacagtgttaccagcatttggagggagcaaaggagtttgctgctgctctcaccgctgagcggataaagaccccaccaaaacgtccaggaggccgcagaagaggacggcttcccaataacagtagcaggcccagcacccccaccattaatgtgctggaatcaaaggatacagacagtgatagggaagcagggactgaaacggggggagagaacaatgataaagaagaagaagagaagaaagatgaaacttcgagctcctctgaagcaaattctcggtgtcaaacaccaataaagatgaagccaaatattgaacctcctgagaatgtggagtggagtggtgctgaagcctcaatgtttagagtcctcattggcacttactatgacaatttctgtgccattgctaggttaattgggaccaaaacatgtagacaggtgtatgagtttagagtcaaagaatctagcatcatagctccagctcccgctgaggatgtggatactcctccaaggaaaaagaagaggaaacaccggttgtgggctgcacactgcagaaagatacagctgaaaaaggacggctcctctaaccatgtttacaactatcaaccctgtgatcatccacggcagccttgtgacagttcgtgcccttgtgtgatagcacaaaatttttgtgaaaagttttgtcaatgtagttcagagtgtcaaaaccgctttccgggatgccgctgcaaagcacagtgcaacaccaagcagtgcccgtgctacctggctgtccgagagtgtgaccctgacctctgtcttacttgtggagccgctgaccattgggacagtaaaaatgtgtcctgcaagaactgcagtattcagcggggctccaaaaagcatctattgctggcaccatctgacgtggcaggctgggggatttttatcaaagatcctgtgcagaaaaatgaattcatctcagaatactgtggagagattatttctcaagatgaagctgacagaagagggaaagtgtatgataaatacatgtgcagctttctgttcaacttgaacaatgattttgtggtggatgcaacccgcaagggtaacaaaattcgttttgcaaatcattcggtaaatccaaactgctatgcaaaagttatgatggttaacggtgatcacaggataggtatttttgccaagagagccatccagactggcgaagagctgttttttgattacagatacagccaggctgatgccctgaagtatgtcggcatcgaaagagaaatggaaatcccttgacatctgctacctcctcccccctcctctgaaacagctgccttagcttcaggaacctcgagtactgtgggcaatttagaaaaagaacatgcagtttgaaattctgaatttgcaaagtactgtaagaataatttatagtaatgagtttaaaaatcaactttttattgccttctcaccagctgcaaagtgttttgtaccagtgaatttttgcaataatgcagtatggtacatttttcaactttgaataaagaatacttgaacttgtccttgttgaatc
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:2146 -> Molecular function: GO:0001047 [core promoter binding] evidence: IEA
GeneID:2146 -> Molecular function: GO:0003677 [DNA binding] evidence: TAS
GeneID:2146 -> Molecular function: GO:0003682 [chromatin binding] evidence: IDA
GeneID:2146 -> Molecular function: GO:0003723 [RNA binding] evidence: IEA
GeneID:2146 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:2146 -> Molecular function: GO:0018024 [histone-lysine N-methyltransferase activity] evidence: IEA
GeneID:2146 -> Molecular function: GO:0042054 [histone methyltransferase activity] evidence: IDA
GeneID:2146 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
GeneID:2146 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IDA
GeneID:2146 -> Biological process: GO:0006325 [chromatin organization] evidence: TAS
GeneID:2146 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
GeneID:2146 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: TAS
GeneID:2146 -> Biological process: GO:0010718 [positive regulation of epithelial to mesenchymal transition] evidence: IDA
GeneID:2146 -> Biological process: GO:0014013 [regulation of gliogenesis] evidence: IEA
GeneID:2146 -> Biological process: GO:0021695 [cerebellar cortex development] evidence: IEA
GeneID:2146 -> Biological process: GO:0032320 [positive regulation of Ras GTPase activity] evidence: IDA
GeneID:2146 -> Biological process: GO:0034244 [negative regulation of transcription elongation from RNA polymerase II promoter] evidence: IEA
GeneID:2146 -> Biological process: GO:0042127 [regulation of cell proliferation] evidence: IEA
GeneID:2146 -> Biological process: GO:0043406 [positive regulation of MAP kinase activity] evidence: IDA
GeneID:2146 -> Biological process: GO:0045605 [negative regulation of epidermal cell differentiation] evidence: IEA
GeneID:2146 -> Biological process: GO:0045814 [negative regulation of gene expression, epigenetic] evidence: IDA
GeneID:2146 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: IMP
GeneID:2146 -> Biological process: GO:0048387 [negative regulation of retinoic acid receptor signaling pathway] evidence: IMP
GeneID:2146 -> Biological process: GO:0051154 [negative regulation of striated muscle cell differentiation] evidence: IEA
GeneID:2146 -> Biological process: GO:0070314 [G1 to G0 transition] evidence: IEA
GeneID:2146 -> Biological process: GO:0070734 [histone H3-K27 methylation] evidence: IEA
GeneID:2146 -> Biological process: GO:0071902 [positive regulation of protein serine/threonine kinase activity] evidence: IDA
GeneID:2146 -> Biological process: GO:2000134 [negative regulation of G1/S transition of mitotic cell cycle] evidence: IEA
GeneID:2146 -> Cellular component: GO:0035098 [ESC/E(Z) complex] evidence: IDA
GeneID:2146 -> Cellular component: GO:0045120 [pronucleus] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_004447 -> EC 2.1.1.43
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.