Home |
Help |
Advanced search
2025-05-09 19:37:38, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_003164 1834 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens syntaxin 5 (STX5), transcript variant 1, mRNA.
ACCESSION NM_003164 XM_938340
VERSION NM_003164.4 GI:347658917
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1834)
AUTHORS Nabeta,M., Abe,Y., Takaoka,Y., Kusanagi,Y. and Ito,M.
TITLE Identification of anti-syntaxin 5 autoantibody as a novel serum
marker of endometriosis
JOURNAL J. Reprod. Immunol. 91 (1-2), 48-55 (2011)
PUBMED 21715015
REMARK GeneRIF: serum anti-STX5 autoantibody, which was discovered by a
proteomic approach, is a potential new serum marker for the
diagnosis of endometriosis.
REFERENCE 2 (bases 1 to 1834)
AUTHORS Renna,M., Schaffner,C., Winslow,A.R., Menzies,F.M., Peden,A.A.,
Floto,R.A. and Rubinsztein,D.C.
TITLE Autophagic substrate clearance requires activity of the syntaxin-5
SNARE complex
JOURNAL J. Cell. Sci. 124 (PT 3), 469-482 (2011)
PUBMED 21242315
REMARK GeneRIF: Depletion of syntaxin-5 complex components results in the
accumulation of autophagosomes as a result of lysosomal
dysfunction, leading to decreased degradation of autophagic
substrates.
REFERENCE 3 (bases 1 to 1834)
AUTHORS Laufman,O., Kedan,A., Hong,W. and Lev,S.
TITLE Direct interaction between the COG complex and the SM protein,
Sly1, is required for Golgi SNARE pairing
JOURNAL EMBO J. 28 (14), 2006-2017 (2009)
PUBMED 19536132
REMARK GeneRIF: Study shows that the SM protein, Sly1, interacts directly
with the conserved oligomeric Golgi (COG) tethering complex;
Sly1-COG interaction is mediated by the Cog4 subunit, which also
interacts with Syntaxin 5 through a different binding site.
REFERENCE 4 (bases 1 to 1834)
AUTHORS Diao,A., Frost,L., Morohashi,Y. and Lowe,M.
TITLE Coordination of golgin tethering and SNARE assembly: GM130 binds
syntaxin 5 in a p115-regulated manner
JOURNAL J. Biol. Chem. 283 (11), 6957-6967 (2008)
PUBMED 18167358
REMARK GeneRIF: depletion of GM130 by RNA interference slows the rate of
ER to Golgi trafficking in vivo; interactions of GM130 with
syntaxin 5 and Rab1 are regulated by mitotic phosphorylation
REFERENCE 5 (bases 1 to 1834)
AUTHORS Shestakova,A., Suvorova,E., Pavliv,O., Khaidakova,G. and
Lupashin,V.
TITLE Interaction of the conserved oligomeric Golgi complex with t-SNARE
Syntaxin5a/Sed5 enhances intra-Golgi SNARE complex stability
JOURNAL J. Cell Biol. 179 (6), 1179-1192 (2007)
PUBMED 18086915
REFERENCE 6 (bases 1 to 1834)
AUTHORS Nichols,B.J. and Pelham,H.R.
TITLE SNAREs and membrane fusion in the Golgi apparatus
JOURNAL Biochim. Biophys. Acta 1404 (1-2), 9-31 (1998)
PUBMED 9714710
REMARK Review article
REFERENCE 7 (bases 1 to 1834)
AUTHORS Hay,J.C., Klumperman,J., Oorschot,V., Steegmaier,M., Kuo,C.S. and
Scheller,R.H.
TITLE Localization, dynamics, and protein interactions reveal distinct
roles for ER and Golgi SNAREs
JOURNAL J. Cell Biol. 141 (7), 1489-1502 (1998)
PUBMED 9647643
REMARK Erratum:[J Cell Biol 1998 Aug 10;142(3):following 881]
REFERENCE 8 (bases 1 to 1834)
AUTHORS Rabouille,C., Kondo,H., Newman,R., Hui,N., Freemont,P. and
Warren,G.
TITLE Syntaxin 5 is a common component of the NSF- and p97-mediated
reassembly pathways of Golgi cisternae from mitotic Golgi fragments
in vitro
JOURNAL Cell 92 (5), 603-610 (1998)
PUBMED 9506515
REFERENCE 9 (bases 1 to 1834)
AUTHORS Hay,J.C., Chao,D.S., Kuo,C.S. and Scheller,R.H.
TITLE Protein interactions regulating vesicle transport between the
endoplasmic reticulum and Golgi apparatus in mammalian cells
JOURNAL Cell 89 (1), 149-158 (1997)
PUBMED 9094723
REFERENCE 10 (bases 1 to 1834)
AUTHORS Ravichandran,V. and Roche,P.A.
TITLE Cloning and identification of human syntaxin 5 as a
synaptobrevin/VAMP binding protein
JOURNAL J. Mol. Neurosci. 8 (2), 159-161 (1997)
PUBMED 9188044
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from CB155395.1, U26648.1 and
BE409085.1.
This sequence is a reference standard in the RefSeqGene project.
On Sep 24, 2011 this sequence version replaced gi:94400931.
Summary: This gene encodes a member of the syntaxin or t-SNARE
(target-SNAP receptor) family. These proteins are found on cell
membranes and serve as the targets for v-SNAREs (vesicle-SNAP
receptors), permitting specific synaptic vesicle docking and
fusion. The encoded protein regulates endoplasmic reticulum to
Golgi transport and plays a critical role in autophagy.
Autoantibodies targeting the encoded protein may be a diagnostic
marker for endometriosis. Alternatively spliced transcript variants
encoding multiple isoforms have been observed for this gene.
[provided by RefSeq, Sep 2011].
Transcript Variant: This variant (1) represents the shorter
transcript and encodes the longer isoform (1).
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BX537426.1, BC012137.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-628 CB155395.1 1-628
629-1553 U26648.1 336-1260
1554-1834 BE409085.1 1-281 c
FEATURES Location/Qualifiers
source 1..1834
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="11"
/map="11q12.3"
gene 1..1834
/gene="STX5"
/gene_synonym="SED5; STX5A"
/note="syntaxin 5"
/db_xref="GeneID:6811"
/db_xref="HGNC:11440"
/db_xref="MIM:603189"
exon 1..138
/gene="STX5"
/gene_synonym="SED5; STX5A"
/inference="alignment:Splign:1.39.8"
misc_feature 98..100
/gene="STX5"
/gene_synonym="SED5; STX5A"
/note="upstream in-frame stop codon"
exon 139..382
/gene="STX5"
/gene_synonym="SED5; STX5A"
/inference="alignment:Splign:1.39.8"
CDS 158..1225
/gene="STX5"
/gene_synonym="SED5; STX5A"
/note="isoform 1 is encoded by transcript variant 1;
syntaxin 5A"
/codon_start=1
/product="syntaxin-5 isoform 1"
/protein_id="NP_003155.2"
/db_xref="GI:94400932"
/db_xref="CCDS:CCDS8038.2"
/db_xref="GeneID:6811"
/db_xref="HGNC:11440"
/db_xref="MIM:603189"
/translation="
MIPRKRYGSKNTDQGVYLGLSKTQVLSPATAGSSSSDIAPLPPPVTLVPPPPDTMSCRDRTQEFLSACKSLQTRQNGIQTNKPALRAVRQRSEFTLMAKRIGKDLSNTFAKLEKLTILAKRKSLFDDKAVEIEELTYIIKQDINSLNKQIAQLQDFVRAKGSQSGRHLQTHSNTIVVSLQSKLASMSNDFKSVLEVRTENLKQQRSRREQFSRAPVSALPLAPNHLGGGAVVLGAESHASKDVAIDMMDSRTSQQLQLIDEQDSYIQSRADTMQNIESTIVELGSIFQQLAHMVKEQEETIQRIDENVLGAQLDVEAAHSEILKYFQSVTSNRWLMVKIFLILIVFFIIFVVFLA
"
misc_feature 425..739
/gene="STX5"
/gene_synonym="SED5; STX5A"
/note="Syntaxin; Region: Syntaxin; pfam00804"
/db_xref="CDD:201451"
misc_feature 953..1132
/gene="STX5"
/gene_synonym="SED5; STX5A"
/note="Soluble NSF (N-ethylmaleimide-sensitive fusion
protein)-Attachment protein (SNAP) REceptor domain; these
alpha-helical motifs form twisted and parallel
heterotetrameric helix bundles; the core complex contains
one helix from a protein that is anchored in...; Region:
t_SNARE; cd00193"
/db_xref="CDD:29155"
misc_feature order(1037..1039,1058..1060,1067..1069)
/gene="STX5"
/gene_synonym="SED5; STX5A"
/note="flanking leucine-zipper layers; other site"
/db_xref="CDD:29155"
misc_feature 1046..1048
/gene="STX5"
/gene_synonym="SED5; STX5A"
/note="zero layer; other site"
/db_xref="CDD:29155"
misc_feature 1157..1219
/gene="STX5"
/gene_synonym="SED5; STX5A"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q13190.2);
transmembrane region"
STS 186..306
/gene="STX5"
/gene_synonym="SED5; STX5A"
/standard_name="RH48793"
/db_xref="UniSTS:11266"
variation 309
/gene="STX5"
/gene_synonym="SED5; STX5A"
/replace="c"
/replace="t"
/db_xref="dbSNP:3802945"
exon 383..453
/gene="STX5"
/gene_synonym="SED5; STX5A"
/inference="alignment:Splign:1.39.8"
exon 454..509
/gene="STX5"
/gene_synonym="SED5; STX5A"
/inference="alignment:Splign:1.39.8"
exon 510..580
/gene="STX5"
/gene_synonym="SED5; STX5A"
/inference="alignment:Splign:1.39.8"
exon 581..697
/gene="STX5"
/gene_synonym="SED5; STX5A"
/inference="alignment:Splign:1.39.8"
variation 631
/gene="STX5"
/gene_synonym="SED5; STX5A"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:2228627"
exon 698..754
/gene="STX5"
/gene_synonym="SED5; STX5A"
/inference="alignment:Splign:1.39.8"
exon 755..836
/gene="STX5"
/gene_synonym="SED5; STX5A"
/inference="alignment:Splign:1.39.8"
exon 837..943
/gene="STX5"
/gene_synonym="SED5; STX5A"
/inference="alignment:Splign:1.39.8"
exon 944..1065
/gene="STX5"
/gene_synonym="SED5; STX5A"
/inference="alignment:Splign:1.39.8"
exon 1066..1834
/gene="STX5"
/gene_synonym="SED5; STX5A"
/inference="alignment:Splign:1.39.8"
STS 1124..1814
/gene="STX5"
/gene_synonym="SED5; STX5A"
/standard_name="STX5A_8658"
/db_xref="UniSTS:468726"
variation 1141
/gene="STX5"
/gene_synonym="SED5; STX5A"
/replace="a"
/replace="t"
/db_xref="dbSNP:2228626"
STS 1236..1476
/gene="STX5"
/gene_synonym="SED5; STX5A"
/standard_name="RH80822"
/db_xref="UniSTS:87760"
variation 1430
/gene="STX5"
/gene_synonym="SED5; STX5A"
/replace="c"
/replace="t"
/db_xref="dbSNP:11557825"
STS 1448..1594
/gene="STX5"
/gene_synonym="SED5; STX5A"
/standard_name="STS-U26648"
/db_xref="UniSTS:69568"
STS 1464..1606
/gene="STX5"
/gene_synonym="SED5; STX5A"
/standard_name="G62080"
/db_xref="UniSTS:139223"
variation 1579
/gene="STX5"
/gene_synonym="SED5; STX5A"
/replace="g"
/replace="t"
/db_xref="dbSNP:10484"
polyA_site 1797
/gene="STX5"
/gene_synonym="SED5; STX5A"
ORIGIN
actgggggtggggttacgtgtaggtgacgtggccgcttccagtctttggtcgggtttcggcggcttcagtgctcggggaggaggcagtgacggccggtgagattggaagtggcggcggcggcaggcggcagaggggagtccgaggttatgcgtctcaatgatcccgcggaaacgctacgggtctaagaacacggatcagggtgtctacctgggtctctcaaagacacaggtcctgtcccctgcaactgctggcagtagcagcagcgacatcgcccctctgccccccccagtgaccctcgtccctccccctcccgacaccatgtcctgccgggatcggacccaggagtttctgtctgcctgcaagtcgctgcagacccgtcagaatggaatccagacaaataagccagctttgcgtgctgtccgacaacgcagtgaattcaccctcatggccaagcgcattgggaaagaccttagcaacacatttgccaagctggagaagctgacaatcttggcaaagcgcaagtccctctttgatgataaagcagtggaaattgaagagctaacatatatcatcaaacaggacatcaatagcctcaacaaacaaattgctcagctccaggatttcgtgagagccaagggcagccagagtggccggcacctgcagacccactccaacaccattgtggtctccttgcagtcgaaactggcttctatgtccaatgacttcaaatcggttttagaagtgaggacagagaacctgaagcagcagaggagccggagagagcagttctcccgggcacctgtgtcagccctgccccttgcccctaaccacctgggcggtggtgctgtggttctgggggcagagtcccatgcctccaaggatgtcgccatcgacatgatggactctcggaccagccagcagctgcagctcattgacgagcaggattcctacatccagagtcgggcagacaccatgcagaacattgagtcgacaattgttgagttgggctccatctttcagcagttggcacacatggttaaggaacaggaggaaaccattcagaggatcgacgagaacgtgctaggagcccagctggacgttgaggccgcccattcagagatcctcaagtacttccagtctgtcacctccaaccggtggctcatggtcaaaatcttcctcatcctcattgtcttcttcatcatctttgtggtcttccttgcttgaaccctctctactctgaggcactctgttggggtttgggaccctcctgggaaggcaagtggccagtgctgccactgagcctgtgcagggtacttgggagaaaggccctgtttccctggaactgctaagaatgaccactgcccctgatcccccaccccttgcctctggccaccctgtcctccccccaccaccctcaggcctatgaaacacacagggttctagatttgaactctgctgtgaagtgactggaagggagcagaggccagctgggggccagtgggggaggttgtttccactaggagatttttataaaccctctccagcctctcccaaaggaagcgttggcagcaaagggagatgatgcccttacccaccttcctgtgagtgaagagaggaagcagccccagggaccaattttcccaattgacctctttcttcctctttcaccatgtgaggcagggagccctgagcccttcagctgcctgcacaacccctgacattggctgctggtgactcaatctgccaaatgtgctgcagctcgttttctcccaattacagcaagactgtcagcctcactagccatgtcatcatttctgggtgggagcgtcgaag
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:6811 -> Molecular function: GO:0005484 [SNAP receptor activity] evidence: IDA
GeneID:6811 -> Molecular function: GO:0047485 [protein N-terminus binding] evidence: IPI
GeneID:6811 -> Biological process: GO:0006886 [intracellular protein transport] evidence: IEA
GeneID:6811 -> Biological process: GO:0006888 [ER to Golgi vesicle-mediated transport] evidence: IEA
GeneID:6811 -> Biological process: GO:0006903 [vesicle targeting] evidence: TAS
GeneID:6811 -> Biological process: GO:0042147 [retrograde transport, endosome to Golgi] evidence: IDA
GeneID:6811 -> Biological process: GO:0048280 [vesicle fusion with Golgi apparatus] evidence: IEA
GeneID:6811 -> Cellular component: GO:0000139 [Golgi membrane] evidence: IEA
GeneID:6811 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:6811 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
GeneID:6811 -> Cellular component: GO:0005783 [endoplasmic reticulum] evidence: IEA
GeneID:6811 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: IDA
GeneID:6811 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
GeneID:6811 -> Cellular component: GO:0031201 [SNARE complex] evidence: TAS
GeneID:6811 -> Cellular component: GO:0033116 [endoplasmic reticulum-Golgi intermediate compartment membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.