Home |
Help |
Advanced search
2025-05-09 19:19:05, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_002230 3508 bp mRNA linear PRI 07-JUL-2013
DEFINITION Homo sapiens junction plakoglobin (JUP), transcript variant 1,
mRNA.
ACCESSION NM_002230
VERSION NM_002230.2 GI:213972609
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3508)
AUTHORS Morgan,R.G., Pearn,L., Liddiard,K., Pumford,S.L., Burnett,A.K.,
Tonks,A. and Darley,R.L.
TITLE gamma-Catenin is overexpressed in acute myeloid leukemia and
promotes the stabilization and nuclear localization of beta-catenin
JOURNAL Leukemia 27 (2), 336-343 (2013)
PUBMED 22858986
REMARK GeneRIF: Overexpression of gamma-catenin is associated with
stabilization and nuclear localization of beta-catenin resulting in
acute myeloid leukemia.
REFERENCE 2 (bases 1 to 3508)
AUTHORS Koyama-Nasu,R., Takahashi,R., Yanagida,S., Nasu-Nishimura,Y.,
Oyama,M., Kozuka-Hata,H., Haruta,R., Manabe,E., Hoshino-Okubo,A.,
Omi,H., Yanaihara,N., Okamoto,A., Tanaka,T. and Akiyama,T.
TITLE The cancer stem cell marker CD133 interacts with plakoglobin and
controls desmoglein-2 protein levels
JOURNAL PLoS ONE 8 (1), E53710 (2013)
PUBMED 23326490
REMARK GeneRIF: CD133 interacts with plakoglobin and knockdown of CD133 by
RNA interference (RNAi) results in the downregulation of
desmoglein-2.
REFERENCE 3 (bases 1 to 3508)
AUTHORS Wex,T., Kuester,D., Monkemuller,K., Stahr,A., Fry,L.C.,
Kandulski,A., Kropf,S., Roessner,A. and Malfertheiner,P.
TITLE Assessment of desmosomal components (desmoglein 1-3, plakoglobin)
in cardia mucosa in relation to gastroesophageal reflux disease and
Helicobacter pylori infection
JOURNAL Hum. Pathol. 43 (10), 1745-1754 (2012)
PUBMED 22521077
REMARK GeneRIF: Gastroesophageal reflux disease was specifically
associated with elevated transcript levels of desmoglein 2 and
plakoglobin
REFERENCE 4 (bases 1 to 3508)
AUTHORS Cooksley-Decasper,S., Reiser,H., Thommen,D.S., Biedermann,B.,
Neidhart,M., Gawinecka,J., Cathomas,G., Franzeck,F.C., Wyss,C.,
Klingenberg,R., Nanni,P., Roschitzki,B., Matter,C., Wolint,P.,
Emmert,M.Y., Husmann,M., Amann-Vesti,B., Maier,W., Gay,S.,
Luscher,T.F., von Eckardstein,A. and Hof,D.
TITLE Antibody phage display assisted identification of junction
plakoglobin as a potential biomarker for atherosclerosis
JOURNAL PLoS ONE 7 (10), E47985 (2012)
PUBMED 23110151
REMARK GeneRIF: Data indicate that plakoglobin and isoforms were present
in atherosclerotic plaques and their secretomes.
REFERENCE 5 (bases 1 to 3508)
AUTHORS Franzen,C.A., Todorovic,V., Desai,B.V., Mirzoeva,S., Yang,X.J.,
Green,K.J. and Pelling,J.C.
TITLE The desmosomal armadillo protein plakoglobin regulates prostate
cancer cell adhesion and motility through vitronectin-dependent Src
signaling
JOURNAL PLoS ONE 7 (7), E42132 (2012)
PUBMED 22860065
REMARK GeneRIF: PG may inhibit Src by keeping VN low. Our results suggest
that loss of intercellular adhesion due to reduced PG expression
might be exacerbated by activation of Src through a PG-dependent
mechanism
REFERENCE 6 (bases 1 to 3508)
AUTHORS Sacco,P.A., McGranahan,T.M., Wheelock,M.J. and Johnson,K.R.
TITLE Identification of plakoglobin domains required for association with
N-cadherin and alpha-catenin
JOURNAL J. Biol. Chem. 270 (34), 20201-20206 (1995)
PUBMED 7650039
REFERENCE 7 (bases 1 to 3508)
AUTHORS Aberle,H., Bierkamp,C., Torchard,D., Serova,O., Wagner,T., Natt,E.,
Wirsching,J., Heidkamper,C., Montagna,M., Lynch,H.T. et al.
TITLE The human plakoglobin gene localizes on chromosome 17q21 and is
subjected to loss of heterozygosity in breast and ovarian cancers
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 92 (14), 6384-6388 (1995)
PUBMED 7604000
REFERENCE 8 (bases 1 to 3508)
AUTHORS Knudsen,K.A. and Wheelock,M.J.
TITLE Plakoglobin, or an 83-kD homologue distinct from beta-catenin,
interacts with E-cadherin and N-cadherin
JOURNAL J. Cell Biol. 118 (3), 671-679 (1992)
PUBMED 1639850
REFERENCE 9 (bases 1 to 3508)
AUTHORS Arnemann,J., Spurr,N.K., Wheeler,G.N., Parker,A.E. and Buxton,R.S.
TITLE Chromosomal assignment of the human genes coding for the major
proteins of the desmosome junction, desmoglein DGI (DSG),
desmocollins DGII/III (DSC), desmoplakins DPI/II (DSP), and
plakoglobin DPIII (JUP)
JOURNAL Genomics 10 (3), 640-645 (1991)
PUBMED 1889810
REFERENCE 10 (bases 1 to 3508)
AUTHORS Franke,W.W., Goldschmidt,M.D., Zimbelmann,R., Mueller,H.M.,
Schiller,D.L. and Cowin,P.
TITLE Molecular cloning and amino acid sequence of human plakoglobin, the
common junctional plaque protein
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 86 (11), 4027-4031 (1989)
PUBMED 2726765
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AC109319.17.
This sequence is a reference standard in the RefSeqGene project.
On Nov 22, 2008 this sequence version replaced gi:4504810.
Summary: This gene encodes a major cytoplasmic protein which is the
only known constituent common to submembranous plaques of both
desmosomes and intermediate junctions. This protein forms distinct
complexes with cadherins and desmosomal cadherins and is a member
of the catenin family since it contains a distinct repeating amino
acid motif called the armadillo repeat. Mutation in this gene has
been associated with Naxos disease. Alternative splicing occurs in
this gene; however, not all transcripts have been fully described.
[provided by RefSeq, Jul 2008].
Transcript Variant: This variant (1) represents the longer
transcript. Variants 1 and 2 encode the same protein.
Sequence Note: The RefSeq transcript and protein were derived from
genomic sequence to make the sequence consistent with the reference
genome assembly. The genomic coordinates used for the transcript
record were based on alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: Z68228.1, M23410.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-125 AC109319.17 81552-81676 c
126-341 AC109319.17 66611-66826 c
342-601 AC109319.17 64382-64641 c
602-840 AC109319.17 63933-64171 c
841-1042 AC109319.17 62343-62544 c
1043-1187 AC109319.17 59887-60031 c
1188-1291 AC109319.17 59677-59780 c
1292-1630 AC109319.17 57947-58285 c
1631-1786 AC109319.17 53679-53834 c
1787-1906 AC109319.17 53363-53482 c
1907-2057 AC109319.17 52598-52748 c
2058-2179 AC109319.17 52379-52500 c
2180-2219 AC109319.17 51139-51178 c
2220-3508 AC109319.17 49571-50859 c
FEATURES Location/Qualifiers
source 1..3508
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="17"
/map="17q21"
gene 1..3508
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/note="junction plakoglobin"
/db_xref="GeneID:3728"
/db_xref="HGNC:6207"
/db_xref="HPRD:01414"
/db_xref="MIM:173325"
exon 1..125
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/inference="alignment:Splign:1.39.8"
exon 126..341
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/inference="alignment:Splign:1.39.8"
CDS 134..2371
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/note="catenin (cadherin-associated protein), gamma 80kDa;
desmoplakin-3; desmoplakin III"
/codon_start=1
/product="junction plakoglobin"
/protein_id="NP_002221.1"
/db_xref="GI:4504811"
/db_xref="CCDS:CCDS11407.1"
/db_xref="GeneID:3728"
/db_xref="HGNC:6207"
/db_xref="HPRD:01414"
/db_xref="MIM:173325"
/translation="
MEVMNLMEQPIKVTEWQQTYTYDSGIHSGANTCVPSVSSKGIMEEDEACGRQYTLKKTTTYTQGVPPSQGDLEYQMSTTARAKRVREAMCPGVSGEDSSLLLATQVEGQATNLQRLAEPSQLLKSAIVHLINYQDDAELATRALPELTKLLNDEDPVVVTKAAMIVNQLSKKEASRRALMGSPQLVAAVVRTMQNTSDLDTARCTTSILHNLSHHREGLLAIFKSGGIPALVRMLSSPVESVLFYAITTLHNLLLYQEGAKMAVRLADGLQKMVPLLNKNNPKFLAITTDCLQLLAYGNQESKLIILANGGPQALVQIMRNYSYEKLLWTTSRVLKVLSVCPSNKPAIVEAGGMQALGKHLTSNSPRLVQNCLWTLRNLSDVATKQEGLESVLKILVNQLSVDDVNVLTCATGTLSNLTCNNSKNKTLVTQNSGVEALIHAILRAGDKDDITEPAVCALRHLTSRHPEAEMAQNSVRLNYGIPAIVKLLNQPNQWPLVKATIGLIRNLALCPANHAPLQEAAVIPRLVQLLVKAHQDAQRHVAAGTQQPYTDGVRMEEIVEGCTGALHILARDPMNRMEIFRLNTIPLFVQLLYSSVENIQRVAAGVLCELAQDKEAADAIDAEGASAPLMELLHSRNEGTATYAAAVLFRISEDKNPDYRKRVSVELTNSLFKHDPAAWEAAQSMIPINEPYGDDMDATYRPMYSSDVPLDPLEMHMDMDGDYPIDTYSDGLRPPYPTADHMLA
"
misc_feature 134..136
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/experiment="experimental evidence, no additional details
recorded"
/note="N-acetylmethionine; propagated from
UniProtKB/Swiss-Prot (P14923.3); acetylation site"
misc_feature 191..193
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 350..>859
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/note="VATPase_H, regulatory vacuolar ATP synthase subunit
H (Vma13p); activation component of the peripheral V1
complex of V-ATPase, a heteromultimeric enzyme which uses
ATP to actively transport protons into organelles and
extracellular compartments. The...; Region: VATPase_H;
cd00256"
/db_xref="CDD:29331"
misc_feature order(458..505,509..538,557..580,587..628,638..661,
668..688,695..712,734..811,815..838,854..859)
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/note="armadillo-like superhelical repeats; other site"
/db_xref="CDD:29331"
misc_feature order(500..502,620..622,743..745,755..757)
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/note="putative peptide binding site; other site"
/db_xref="CDD:29331"
misc_feature 527..1024
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P14923.3);
Region: Interaction with DSC1 and DSG1"
misc_feature 530..532
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00655"
misc_feature 677..679
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P14923.3); phosphorylation site"
misc_feature 677..679
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 791..1150
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/note="Armadillo/beta-catenin-like repeats. An
approximately 40 amino acid long tandemly repeated
sequence motif first identified in the Drosophila segment
polarity gene armadillo; these repeats were also found in
the mammalian armadillo homolog beta-catenin; Region: ARM;
cd00020"
/db_xref="CDD:28904"
misc_feature order(863..865,875..877,887..889,980..982,992..994,
1001..1003,1013..1015,1121..1123,1130..1132,1139..1144)
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/note="protein binding surface [polypeptide binding];
other site"
/db_xref="CDD:28904"
misc_feature 1025..1156
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P14923.3);
Region: ARM 5"
misc_feature 1049..1390
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/note="Armadillo/beta-catenin-like repeats. An
approximately 40 amino acid long tandemly repeated
sequence motif first identified in the Drosophila segment
polarity gene armadillo; these repeats were also found in
the mammalian armadillo homolog beta-catenin; Region: ARM;
cd00020"
/db_xref="CDD:28904"
misc_feature order(1118..1120,1130..1132,1142..1144,1232..1234,
1244..1246,1253..1255,1265..1267,1361..1363,1370..1372,
1379..1384)
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/note="protein binding surface [polypeptide binding];
other site"
/db_xref="CDD:28904"
misc_feature 1157..1276
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P14923.3);
Region: ARM 6"
misc_feature 1280..1393
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P14923.3);
Region: ARM 7"
misc_feature 1301..1660
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/note="Armadillo/beta-catenin-like repeats. An
approximately 40 amino acid long tandemly repeated
sequence motif first identified in the Drosophila segment
polarity gene armadillo; these repeats were also found in
the mammalian armadillo homolog beta-catenin; Region: ARM;
cd00020"
/db_xref="CDD:28904"
misc_feature order(1358..1360,1370..1372,1382..1384,1481..1483,
1493..1495,1502..1504,1514..1516,1631..1633,1640..1642,
1649..1654)
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/note="protein binding surface [polypeptide binding];
other site"
/db_xref="CDD:28904"
misc_feature 1400..1525
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P14923.3);
Region: ARM 8"
misc_feature 1541..1663
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P14923.3);
Region: ARM 9"
misc_feature 1559..1966
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/note="Armadillo/beta-catenin-like repeats. An
approximately 40 amino acid long tandemly repeated
sequence motif first identified in the Drosophila segment
polarity gene armadillo; these repeats were also found in
the mammalian armadillo homolog beta-catenin; Region: ARM;
cd00020"
/db_xref="CDD:28904"
misc_feature order(1628..1630,1640..1642,1652..1654,1805..1807,
1817..1819,1826..1828,1838..1840,1940..1942,1949..1951,
1958..1963)
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/note="protein binding surface [polypeptide binding];
other site"
/db_xref="CDD:28904"
misc_feature 1667..1786
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P14923.3);
Region: ARM 10"
misc_feature 1781..1783
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:01491"
misc_feature 1781..1783
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00655"
misc_feature 1853..2116
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P14923.3);
Region: Interaction with DSC1"
misc_feature 2063..2065
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:01819"
misc_feature 2111..2113
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 2126..2128
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P14923.3); phosphorylation site"
misc_feature 2126..2128
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
exon 342..601
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/inference="alignment:Splign:1.39.8"
exon 602..840
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/inference="alignment:Splign:1.39.8"
STS 650..902
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/standard_name="JUP"
/db_xref="UniSTS:44727"
exon 841..1042
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/inference="alignment:Splign:1.39.8"
exon 1043..1187
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/inference="alignment:Splign:1.39.8"
exon 1188..1291
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/inference="alignment:Splign:1.39.8"
exon 1292..1630
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/inference="alignment:Splign:1.39.8"
variation 1357
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/replace="c"
/replace="t"
/db_xref="dbSNP:2230408"
exon 1631..1786
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/inference="alignment:Splign:1.39.8"
exon 1787..1906
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/inference="alignment:Splign:1.39.8"
exon 1907..2057
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/inference="alignment:Splign:1.39.8"
exon 2058..2179
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/inference="alignment:Splign:1.39.8"
exon 2180..2219
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/inference="alignment:Splign:1.39.8"
STS 2218..2365
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/standard_name="Jup"
/db_xref="UniSTS:143648"
exon 2220..3508
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/inference="alignment:Splign:1.39.8"
STS 2794..2911
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/standard_name="G07167"
/db_xref="UniSTS:55163"
STS 3013..3138
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/standard_name="RH17679"
/db_xref="UniSTS:54645"
variation 3328
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/replace="c"
/replace="t"
/db_xref="dbSNP:1126985"
STS 3345..3483
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/standard_name="SHGC-30259"
/db_xref="UniSTS:80066"
variation 3371
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
/replace="a"
/replace="c"
/db_xref="dbSNP:1801501"
polyA_signal 3488..3493
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
polyA_site 3508
/gene="JUP"
/gene_synonym="ARVD12; CTNNG; DP3; DPIII; PDGB; PKGB"
ORIGIN
tgagttgctgccttggccagagtccggagcagccgccgcccgaccacgccgagctcagttcgctgtccgcgccggctcccaccccggcccgaccccgacccggcccggtcaggccccatactcagtagccacgatggaggtgatgaacctgatggagcagcctatcaaggtgactgagtggcagcagacatacacctacgactcgggtatccactcgggcgccaacacctgcgtgccctccgtcagcagcaagggcatcatggaggaggatgaggcctgcgggcgccagtacacgctcaagaaaaccaccacttacacccagggggtgccccccagccaaggtgatctggagtaccagatgtccacaacagccagggccaaacgggtgcgggaggccatgtgccctggtgtgtcaggcgaggacagctcgcttctgctggccacccaggtggaggggcaggccaccaacctgcagcgactggccgagccgtcccagctgctcaagtcggccattgtgcatctcatcaactaccaggacgatgccgagctggccactcgcgccctgcccgagctcaccaaactgctcaacgacgaggacccggtggtggtgaccaaggcggccatgattgtgaaccagctgtcgaagaaggaggcgtcgcggcgggccctgatgggctcgccccagctggtggccgctgtcgtgcgtaccatgcagaataccagcgacctggacacagcccgctgcaccaccagcatcctgcacaacctctcccaccaccgggaggggctgctcgccatcttcaagtcgggtggcatccctgctctggtccgcatgctcagctcccctgtggagtcggtcctgttctatgccatcaccacgctgcacaacctgctcctgtaccaggagggcgccaagatggccgtgcgcctggccgacgggctgcaaaagatggtgcccctgctcaacaagaacaaccccaagttcctggccatcaccaccgactgcctgcagctcctggcctacggcaaccaggagagcaagctgatcatcctggccaatggtgggccccaggccctcgtgcagatcatgcgtaactacagttatgaaaagctgctctggaccaccagtcgtgtgctcaaggtgctatccgtgtgtcccagcaataagcctgccattgtggaggctggtgggatgcaggccctgggcaagcacctgaccagcaacagcccccgcctggtgcagaactgcctgtggaccctgcgcaacctctcagatgtggccaccaagcaggagggcctggagagtgtgctgaagattctggtgaatcagctgagtgtggatgacgtcaacgtcctcacctgtgccacgggcacactctccaacctgacatgcaacaacagcaagaacaagacgctggtgacacagaacagcggtgtggaggctctcatccatgccatcctgcgtgctggtgacaaggacgacatcacggagcctgccgtctgcgctctgcgccacctcactagccgccaccctgaggccgagatggcccagaactctgtgcgtctcaactatggcatcccagccatcgtgaagctgctcaaccagcccaaccagtggccactggtcaaggcaaccatcggcttgatcaggaatctggccctgtgcccagccaaccatgccccgctgcaggaggcagcggtcatcccccgcctcgtccaactgctggtgaaggcccaccaggatgcccagcgccacgtagctgcaggcacacagcagccctacacggatggtgtgaggatggaggagattgtggagggctgcaccggagcactgcacatcctcgcccgggaccccatgaaccgcatggagatcttccggctcaacaccattcccctgtttgtgcagctcctgtactcgtcggtggagaacatccagcgcgtggctgccggggtgctgtgtgagctggcccaggacaaggaggcggccgacgccattgatgcagagggggcctcggccccactcatggagttgctgcactcccgcaacgagggcactgccacctacgctgctgccgtcctgttccgcatctccgaggacaagaacccagactaccggaagcgcgtgtccgtggagctcaccaactccctcttcaagcatgacccggctgcctgggaggctgcccagagcatgattcccatcaatgagccctatggagatgacatggatgccacctaccgccccatgtactccagcgatgtgccccttgacccgctggagatgcacatggacatggatggagactaccccatcgacacctacagcgacggcctcaggcccccgtaccccactgcagaccacatgctggcctaggcggcctggccccagtacggccccctctttgcaggcttttcctcctctctagaacctccttctgttggaggccctcccatctccccgctgaaacctgcgctccttttttggggggatcctttgctgctgagcttccccaagcacggtgtgccctggcctgccttcttcttgtgtctttggtggggatggggaggcctattcctgctggccccttctgggggtggtgggcaggtgacacggagtggcttgagcttctggggatgcaggtccaccgagcccctgacccctgtctgtccccgctcccctaacaggtgcggttcctcatctgagaggctctccgtgcaggcgatggggcaagacagaaaagtgcctgagctggggaagccggggtgtaacttcctgctgcaccctgcgcctccagaggtcctccgtagggtctttcttgggatagtgttctgctcctgcttttctgtcctgggcatgggtccagggcctgacaccccctccccgcccctgtggccctggccactaaagcttcagactcaagtacccattctgttttcccccagcaacgcccctccaaacctccagcctccctgtctccagctgcctgggcccggaagggctttggttccttctctgggtctgattttctcactgaactccaccgaccaactgccctaagcccccagggcctccagggcccaggttcgagacccaaacccccaaaatccaaaacttctcttgaaaagttcagggaccgtccaggggagatggggaggagatatggagtgagtcacctgctccagaagatgccagcttctctctccagggtgcttagttggctttgcccacccctcactccccagggagctctggggacagcttcctcacacccctgtcccacccacacagctgccctagctgaccccgagaagtgctcttggctgacccctctggtgtgtggtgaggggctttctcttccccttcctgtttcagacccccccatttcccgcacatggtgtggggggctgggggaggtccaagcagagtgttttattattatcgctttatgtttttggttattggtttttttgtatagaccaaagcaaagaaaataaaaataacacagatgcg
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:3728 -> Molecular function: GO:0003713 [transcription coactivator activity] evidence: IDA
GeneID:3728 -> Molecular function: GO:0005198 [structural molecule activity] evidence: IBA
GeneID:3728 -> Molecular function: GO:0005198 [structural molecule activity] evidence: NAS
GeneID:3728 -> Molecular function: GO:0005199 [structural constituent of cell wall] evidence: IC
GeneID:3728 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:3728 -> Molecular function: GO:0019901 [protein kinase binding] evidence: IBA
GeneID:3728 -> Molecular function: GO:0019903 [protein phosphatase binding] evidence: IPI
GeneID:3728 -> Molecular function: GO:0042803 [protein homodimerization activity] evidence: ISS
GeneID:3728 -> Molecular function: GO:0045294 [alpha-catenin binding] evidence: IPI
GeneID:3728 -> Molecular function: GO:0045296 [cadherin binding] evidence: IPI
GeneID:3728 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IKR
GeneID:3728 -> Biological process: GO:0000902 [cell morphogenesis] evidence: IBA
GeneID:3728 -> Biological process: GO:0002159 [desmosome assembly] evidence: IDA
GeneID:3728 -> Biological process: GO:0003136 [negative regulation of heart induction by canonical Wnt receptor signaling pathway] evidence: IBA
GeneID:3728 -> Biological process: GO:0003181 [atrioventricular valve morphogenesis] evidence: IBA
GeneID:3728 -> Biological process: GO:0003308 [negative regulation of Wnt receptor signaling pathway involved in heart development] evidence: IBA
GeneID:3728 -> Biological process: GO:0007016 [cytoskeletal anchoring at plasma membrane] evidence: IBA
GeneID:3728 -> Biological process: GO:0007016 [cytoskeletal anchoring at plasma membrane] evidence: NAS
GeneID:3728 -> Biological process: GO:0007369 [gastrulation] evidence: IBA
GeneID:3728 -> Biological process: GO:0007398 [ectoderm development] evidence: IBA
GeneID:3728 -> Biological process: GO:0007399 [nervous system development] evidence: IBA
GeneID:3728 -> Biological process: GO:0016331 [morphogenesis of embryonic epithelium] evidence: IBA
GeneID:3728 -> Biological process: GO:0016337 [cell-cell adhesion] evidence: IDA
GeneID:3728 -> Biological process: GO:0016477 [cell migration] evidence: IMP
GeneID:3728 -> Biological process: GO:0034329 [cell junction assembly] evidence: TAS
GeneID:3728 -> Biological process: GO:0034332 [adherens junction organization] evidence: TAS
GeneID:3728 -> Biological process: GO:0042127 [regulation of cell proliferation] evidence: IDA
GeneID:3728 -> Biological process: GO:0042307 [positive regulation of protein import into nucleus] evidence: IDA
GeneID:3728 -> Biological process: GO:0043588 [skin development] evidence: IBA
GeneID:3728 -> Biological process: GO:0045216 [cell-cell junction organization] evidence: TAS
GeneID:3728 -> Biological process: GO:0048599 [oocyte development] evidence: IBA
GeneID:3728 -> Biological process: GO:0050982 [detection of mechanical stimulus] evidence: IDA
GeneID:3728 -> Biological process: GO:0051091 [positive regulation of sequence-specific DNA binding transcription factor activity] evidence: IDA
GeneID:3728 -> Biological process: GO:0051291 [protein heterooligomerization] evidence: IEA
GeneID:3728 -> Biological process: GO:0071603 [endothelial cell-cell adhesion] evidence: ISS
GeneID:3728 -> Biological process: GO:0071681 [cellular response to indole-3-methanol] evidence: IDA
GeneID:3728 -> Biological process: GO:0086005 [regulation of ventricular cardiac muscle cell action potential] evidence: IMP
GeneID:3728 -> Biological process: GO:0086069 [bundle of His cell to Purkinje myocyte communication] evidence: IMP
GeneID:3728 -> Biological process: GO:0086091 [regulation of heart rate by cardiac conduction] evidence: IMP
GeneID:3728 -> Biological process: GO:0090263 [positive regulation of canonical Wnt receptor signaling pathway] evidence: IC
GeneID:3728 -> Cellular component: GO:0005634 [nucleus] evidence: IMP
GeneID:3728 -> Cellular component: GO:0005667 [transcription factor complex] evidence: IKR
GeneID:3728 -> Cellular component: GO:0005737 [cytoplasm] evidence: IMP
GeneID:3728 -> Cellular component: GO:0005829 [cytosol] evidence: ISS
GeneID:3728 -> Cellular component: GO:0005856 [cytoskeleton] evidence: ISS
GeneID:3728 -> Cellular component: GO:0005882 [intermediate filament] evidence: IEA
GeneID:3728 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
GeneID:3728 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
GeneID:3728 -> Cellular component: GO:0005911 [cell-cell junction] evidence: IDA
GeneID:3728 -> Cellular component: GO:0005913 [cell-cell adherens junction] evidence: IDA
GeneID:3728 -> Cellular component: GO:0005915 [zonula adherens] evidence: IBA
GeneID:3728 -> Cellular component: GO:0005915 [zonula adherens] evidence: ISS
GeneID:3728 -> Cellular component: GO:0005916 [fascia adherens] evidence: IBA
GeneID:3728 -> Cellular component: GO:0009898 [internal side of plasma membrane] evidence: IBA
GeneID:3728 -> Cellular component: GO:0009898 [internal side of plasma membrane] evidence: ISS
GeneID:3728 -> Cellular component: GO:0014704 [intercalated disc] evidence: IDA
GeneID:3728 -> Cellular component: GO:0015629 [actin cytoskeleton] evidence: IBA
GeneID:3728 -> Cellular component: GO:0016323 [basolateral plasma membrane] evidence: IBA
GeneID:3728 -> Cellular component: GO:0016327 [apicolateral plasma membrane] evidence: IEA
GeneID:3728 -> Cellular component: GO:0016328 [lateral plasma membrane] evidence: IEA
GeneID:3728 -> Cellular component: GO:0016342 [catenin complex] evidence: IDA
GeneID:3728 -> Cellular component: GO:0030018 [Z disc] evidence: IBA
GeneID:3728 -> Cellular component: GO:0030056 [hemidesmosome] evidence: ISS
GeneID:3728 -> Cellular component: GO:0030057 [desmosome] evidence: IDA
GeneID:3728 -> Cellular component: GO:0032993 [protein-DNA complex] evidence: IDA
GeneID:3728 -> Cellular component: GO:0071665 [gamma-catenin-TCF7L2 complex] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.