Home |
Help |
Advanced search
2025-05-09 20:08:48, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001260493 2511 bp mRNA linear PRI 07-JUL-2013
DEFINITION Homo sapiens radixin (RDX), transcript variant 2, mRNA.
ACCESSION NM_001260493
VERSION NM_001260493.1 GI:386781570
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2511)
AUTHORS Titushkin,I., Sun,S., Paul,A. and Cho,M.
TITLE Control of adipogenesis by ezrin, radixin and moesin-dependent
biomechanics remodeling
JOURNAL J Biomech 46 (3), 521-526 (2013)
PUBMED 23116763
REMARK GeneRIF: Control of adipogenesis by ezrin, radixin and
moesin-dependent biomechanics remodeling.
REFERENCE 2 (bases 1 to 2511)
AUTHORS Zhang,L., Xiao,R., Xiong,J., Leng,J., Ehtisham,A., Hu,Y., Ding,Q.,
Xu,H., Liu,S., Wang,J., Tang,D.G. and Zhang,Q.
TITLE Activated ERM protein plays a critical role in drug resistance of
MOLT4 cells induced by CCL25
JOURNAL PLoS ONE 8 (1), E52384 (2013)
PUBMED 23326330
REMARK GeneRIF: Data suggest that P-glycoprotein associate with the
F-actin cytoskeleton through ezrin/radixin/moesin (ERM) in
CCR9/CCL25 induced multidrug resistance of acute T-lymphocytic
leukemia (T-ALL) cells.
REFERENCE 3 (bases 1 to 2511)
AUTHORS Darmellah,A., Rayah,A., Auger,R., Cuif,M.H., Prigent,M., Arpin,M.,
Alcover,A., Delarasse,C. and Kanellopoulos,J.M.
TITLE Ezrin/radixin/moesin are required for the purinergic P2X7 receptor
(P2X7R)-dependent processing of the amyloid precursor protein
JOURNAL J. Biol. Chem. 287 (41), 34583-34595 (2012)
PUBMED 22891241
REMARK GeneRIF: Ezrin/radixin/moesin are required for the purinergic P2X7
receptor (P2X7R)-dependent processing of the amyloid precursor
protein.
REFERENCE 4 (bases 1 to 2511)
AUTHORS Perez-Cornejo,P., Gokhale,A., Duran,C., Cui,Y., Xiao,Q.,
Hartzell,H.C. and Faundez,V.
TITLE Anoctamin 1 (Tmem16A) Ca2+-activated chloride channel
stoichiometrically interacts with an ezrin-radixin-moesin network
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 109 (26), 10376-10381 (2012)
PUBMED 22685202
REMARK GeneRIF: Ano1, ezrin, and moesin/radixin colocalize apically in
salivary gland epithelial cells, and overexpression of moesin and
Ano1 in HEK cells alters the subcellular localization of both
proteins
REFERENCE 5 (bases 1 to 2511)
AUTHORS Chen,S.D., Song,M.M., Zhong,Z.Q., Li,N., Wang,P.L., Cheng,S.,
Bai,R.X. and Yuan,H.S.
TITLE Knockdown of radixin by RNA interference suppresses the growth of
human pancreatic cancer cells in vitro and in vivo
JOURNAL Asian Pac. J. Cancer Prev. 13 (3), 753-759 (2012)
PUBMED 22631643
REMARK GeneRIF: results suggest that radixin might play a critical role in
pancreatic cancer progression, possibly through involvement of
down-regulation of TSP-1 and E-cadherin expression.
REFERENCE 6 (bases 1 to 2511)
AUTHORS Takahashi,K., Sasaki,T., Mammoto,A., Takaishi,K., Kameyama,T.,
Tsukita,S. and Takai,Y.
TITLE Direct interaction of the Rho GDP dissociation inhibitor with
ezrin/radixin/moesin initiates the activation of the Rho small G
protein
JOURNAL J. Biol. Chem. 272 (37), 23371-23375 (1997)
PUBMED 9287351
REFERENCE 7 (bases 1 to 2511)
AUTHORS Stemmer-Rachamimov,A.O., Gonzalez-Agosti,C., Xu,L., Burwick,J.A.,
Beauchamp,R., Pinney,D., Louis,D.N. and Ramesh,V.
TITLE Expression of NF2-encoded merlin and related ERM family proteins in
the human central nervous system
JOURNAL J. Neuropathol. Exp. Neurol. 56 (6), 735-742 (1997)
PUBMED 9184664
REFERENCE 8 (bases 1 to 2511)
AUTHORS Hirao,M., Sato,N., Kondo,T., Yonemura,S., Monden,M., Sasaki,T.,
Takai,Y., Tsukita,S. and Tsukita,S.
TITLE Regulation mechanism of ERM (ezrin/radixin/moesin) protein/plasma
membrane association: possible involvement of phosphatidylinositol
turnover and Rho-dependent signaling pathway
JOURNAL J. Cell Biol. 135 (1), 37-51 (1996)
PUBMED 8858161
REFERENCE 9 (bases 1 to 2511)
AUTHORS Wilgenbus,K.K., Milatovich,A., Francke,U. and Furthmayr,H.
TITLE Molecular cloning, cDNA sequence, and chromosomal assignment of the
human radixin gene and two dispersed pseudogenes
JOURNAL Genomics 16 (1), 199-206 (1993)
PUBMED 8486357
REFERENCE 10 (bases 1 to 2511)
AUTHORS Sato,N., Funayama,N., Nagafuchi,A., Yonemura,S., Tsukita,S. and
Tsukita,S.
TITLE A gene family consisting of ezrin, radixin and moesin. Its specific
localization at actin filament/plasma membrane association sites
JOURNAL J. Cell. Sci. 103 (PT 1), 131-143 (1992)
PUBMED 1429901
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from DQ916742.1.
Summary: Radixin is a cytoskeletal protein that may be important in
linking actin to the plasma membrane. It is highly similar in
sequence to both ezrin and moesin. The radixin gene has been
localized by fluorescence in situ hybridization to 11q23. A
truncated version representing a pseudogene (RDXP2) was assigned to
Xp21.3. Another pseudogene that seemed to lack introns (RDXP1) was
mapped to 11p by Southern and PCR analyses. Multiple alternatively
spliced transcript variants encoding different isoforms have been
found for this gene. [provided by RefSeq, May 2012].
Transcript Variant: This variant (2) differs in the 3' UTR exon,
compared to variant 1. Both variants 1 and 2 encode the same
isoform 1.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: DQ916742.1 [ECO:0000332]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-2511 DQ916742.1 1-2511
FEATURES Location/Qualifiers
source 1..2511
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="11"
/map="11q23"
gene 1..2511
/gene="RDX"
/gene_synonym="DFNB24"
/note="radixin"
/db_xref="GeneID:5962"
/db_xref="HGNC:9944"
/db_xref="MIM:179410"
exon 1..246
/gene="RDX"
/gene_synonym="DFNB24"
/inference="alignment:Splign:1.39.8"
variation 182..183
/gene="RDX"
/gene_synonym="DFNB24"
/replace=""
/replace="a"
/db_xref="dbSNP:71053883"
exon 247..322
/gene="RDX"
/gene_synonym="DFNB24"
/inference="alignment:Splign:1.39.8"
misc_feature 254..256
/gene="RDX"
/gene_synonym="DFNB24"
/note="upstream in-frame stop codon"
CDS 311..2125
/gene="RDX"
/gene_synonym="DFNB24"
/note="isoform 1 is encoded by transcript variant 2"
/codon_start=1
/product="radixin isoform 1"
/protein_id="NP_001247422.1"
/db_xref="GI:386781571"
/db_xref="CCDS:CCDS58174.1"
/db_xref="GeneID:5962"
/db_xref="HGNC:9944"
/db_xref="MIM:179410"
/translation="
MPKPINVRVTTMDAELEFAIQPNTTGKQLFDQVVKTVGLREVWFFGLQYVDSKGYSTWLKLNKKVTQQDVKKENPLQFKFRAKFFPEDVSEELIQEITQRLFFLQVKEAILNDEIYCPPETAVLLASYAVQAKYGDYNKEIHKPGYLANDRLLPQRVLEQHKLTKEQWEERIQNWHEEHRGMLREDSMMEYLKIAQDLEMYGVNYFEIKNKKGTELWLGVDALGLNIYEHDDKLTPKIGFPWSEIRNISFNDKKFVIKPIDKKAPDFVFYAPRLRINKRILALCMGNHELYMRRRKPDTIEVQQMKAQAREEKHQKQLERAQLENEKKKREIAEKEKERIEREKEELMERLKQIEEQTIKAQKELEEQTRKALELDQERKRAKEEAERLEKERRAAEEAKSAIAKQAADQMKNQEQLAAELAEFTAKIALLEEAKKKKEEEATEWQHKAFAAQEDLEKTKEELKTVMSAPPPPPPPPVIPPTENEHDEHDENNAEASAELSNEGVMNHRSEEERVTETQKNERVKKQLQALSSELAQARDETKKTQNDVLHAENVKAGRDKYKTLRQIRQGNTKQRIDEFEAMWGPKLYALFQMRSCQSSIKQM
"
mat_peptide 311..2059
/gene="RDX"
/gene_synonym="DFNB24"
/product="Radixin"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P35241.1)"
misc_feature 329..928
/gene="RDX"
/gene_synonym="DFNB24"
/note="Band 4.1 homologues; Region: B41; smart00295"
/db_xref="CDD:197635"
misc_feature 335..568
/gene="RDX"
/gene_synonym="DFNB24"
/note="FERM N-terminal domain; Region: FERM_N; pfam09379"
/db_xref="CDD:204220"
misc_feature 488..499
/gene="RDX"
/gene_synonym="DFNB24"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (P35241.1);
Region: Phosphatidylinositol binding (By similarity)"
misc_feature 587..928
/gene="RDX"
/gene_synonym="DFNB24"
/note="FERM central domain; Region: FERM_M; pfam00373"
/db_xref="CDD:201187"
misc_feature 908..1186
/gene="RDX"
/gene_synonym="DFNB24"
/note="FERM_C domain; Region: FERM_C; cd00836"
/db_xref="CDD:176273"
misc_feature order(920..943,950..973,977..997,1034..1039,1046..1057,
1070..1090,1106..1120,1145..1171)
/gene="RDX"
/gene_synonym="DFNB24"
/note="PH/PTB-like core; other site"
/db_xref="CDD:176273"
misc_feature order(1043..1045,1049..1054,1058..1066,1088..1090,
1151..1153,1163..1165,1172..1174,1184..1186)
/gene="RDX"
/gene_synonym="DFNB24"
/note="peptide binding site [polypeptide binding]; other
site"
/db_xref="CDD:176273"
misc_feature 1142..1144
/gene="RDX"
/gene_synonym="DFNB24"
/note="lipid binding site [chemical binding];
lipid-binding site"
/db_xref="CDD:176273"
misc_feature 1367..2059
/gene="RDX"
/gene_synonym="DFNB24"
/note="Ezrin/radixin/moesin family; Region: ERM;
pfam00769"
/db_xref="CDD:109812"
exon 323..406
/gene="RDX"
/gene_synonym="DFNB24"
/inference="alignment:Splign:1.39.8"
exon 407..502
/gene="RDX"
/gene_synonym="DFNB24"
/inference="alignment:Splign:1.39.8"
exon 503..777
/gene="RDX"
/gene_synonym="DFNB24"
/inference="alignment:Splign:1.39.8"
exon 778..861
/gene="RDX"
/gene_synonym="DFNB24"
/inference="alignment:Splign:1.39.8"
STS 831..969
/gene="RDX"
/gene_synonym="DFNB24"
/standard_name="RDX"
/db_xref="UniSTS:504078"
exon 862..1008
/gene="RDX"
/gene_synonym="DFNB24"
/inference="alignment:Splign:1.39.8"
exon 1009..1105
/gene="RDX"
/gene_synonym="DFNB24"
/inference="alignment:Splign:1.39.8"
exon 1106..1269
/gene="RDX"
/gene_synonym="DFNB24"
/inference="alignment:Splign:1.39.8"
STS 1233..1580
/gene="RDX"
/gene_synonym="DFNB24"
/standard_name="GDB:196850"
/db_xref="UniSTS:155890"
exon 1270..1400
/gene="RDX"
/gene_synonym="DFNB24"
/inference="alignment:Splign:1.39.8"
exon 1401..1561
/gene="RDX"
/gene_synonym="DFNB24"
/inference="alignment:Splign:1.39.8"
exon 1562..1654
/gene="RDX"
/gene_synonym="DFNB24"
/inference="alignment:Splign:1.39.8"
exon 1655..1897
/gene="RDX"
/gene_synonym="DFNB24"
/inference="alignment:Splign:1.39.8"
exon 1898..2096
/gene="RDX"
/gene_synonym="DFNB24"
/inference="alignment:Splign:1.39.8"
ORIGIN
ttggcgctcagtccgcggcgcgaggacggccggccggcagggggaggcgggggggcgccgggcagccccgccttttcccgcggaggcgccgagcggccatattgcggagctgtctgcggtggcggcggcgcctctcgtctcccgcggcccagcgctcgcaccaccgcttctccctccctgtcgcagccgcgccgccgcgcagcgccccagccacacgccggcgggcagaagccgcccgctctccggaaagtgataacagaattcattgaagtggagaatttttaaagaaggtaacaaaaagagaaagaaaatgccgaaaccaatcaacgtaagagtaactacaatggatgctgagctggaatttgccattcagcccaatacaactggcaaacaactttttgaccaggtggtgaaaacagttggtttgcgtgaggtctggttttttgggctgcagtatgtagacagcaaaggttattctacatggcttaaactaaataaaaaggtaacacagcaggatgttaaaaaagagaatcctttacagttcaagtttagagctaaattctttcctgaagatgtttctgaggaattaattcaagaaataacccagagactcttcttcttgcaagttaaagaagccatcttaaatgatgagatatattgcccgccagaaactgcagttcttttggcttcctatgctgtccaagccaagtatggagattacaataaagagattcataagccaggctacctggctaatgatagactcctaccccagcgtgtattggaacaacacaaactaacaaaagaacagtgggaagaaagaatacagaactggcatgaagaacatagaggaatgttaagggaggattctatgatggaatacctgaagattgcacaagatctagaaatgtatggagtcaactattttgaaataaaaaataaaaaaggaactgaattgtggctaggtgttgatgctttgggtctgaatatttatgagcatgacgacaagttaacacctaaaattggttttccctggagtgaaatcagaaatatttcatttaatgacaaaaaatttgttataaagccaatcgacaaaaaggcacctgattttgtgttttatgcacctcgtctgagaatcaataagcggattttggccttatgtatgggaaaccatgaactatacatgcgaagaaggaagcctgatactattgaagtacaacagatgaaggctcaggctagggaggagaaacatcagaagcagttggaaagggcacaattagagaatgaaaagaagaaaagagaaatagcagaaaaggaaaaggaaagaatagaacgtgaaaaggaagagctaatggaacgtctaaaacaaattgaagagcagacaattaaagctcagaaagaactagaagaacagactcgaaaagctctagaactggatcaagaacgaaaacgagcaaaagaagaagcagaacgacttgaaaaggagcgtcgagctgctgaagaggcaaagtctgccatagcaaaacaagctgccgaccagatgaagaatcaggagcagctagcagcagaacttgctgaattcactgccaagattgcacttctagaggaagccaagaagaaaaaggaagaggaagctactgagtggcaacacaaagcttttgcagcccaggaagacttggaaaagaccaaagaagagttaaaaactgtgatgtctgccccccctccacctccaccaccaccagtcattcctccaacagaaaacgaacatgatgaacacgatgagaataatgctgaagctagtgctgaattatcaaatgaaggggtaatgaaccatagaagcgaggaagaacgtgtaaccgaaacacagaaaaatgagcgtgttaagaagcaacttcaggcattaagttcagaattagcccaagccagagatgaaaccaagaaaacacaaaatgatgttcttcatgctgagaatgttaaagcaggccgtgataagtacaagactctgcgacagattcgacaaggcaatacaaagcagcgtatcgatgagtttgaagcaatgtggggacccaaactgtatgcattgttccagatgcgctcttgccaaagcagcataaagcaaatgtaacccttaggaagaaggctccctccctcactagggctacaaagaatgctagagtggagacaagagtccagactctgaaataacctcctttggacacagaagctaccactgttgcttatcagacgcagcgggccctgggtttttctggggccttaagcagtgaaccctggtcagctggcctgagtcccaacccaagcccatcaccacaagcctcaagacaggaagatctcagtgaaacctttcctctaatccaagtgacatcattgtcgcaggtgtttgtacatgaaagcagagtgatgaaggtgtgtgggtccacggaagaagtaaaaatacagcactagttcatatttttcctagtctctccctgttcccaggtaaagttatagcat
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:5962 -> Molecular function: GO:0003779 [actin binding] evidence: IEA
GeneID:5962 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:5962 -> Biological process: GO:0051693 [actin filament capping] evidence: IEA
GeneID:5962 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
GeneID:5962 -> Cellular component: GO:0005856 [cytoskeleton] evidence: IEA
GeneID:5962 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
GeneID:5962 -> Cellular component: GO:0005925 [focal adhesion] evidence: IDA
GeneID:5962 -> Cellular component: GO:0019898 [extrinsic to membrane] evidence: IEA
GeneID:5962 -> Cellular component: GO:0032154 [cleavage furrow] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.