Home |
Help |
Advanced search
2025-05-09 19:32:38, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001225 1319 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens caspase 4, apoptosis-related cysteine peptidase
(CASP4), transcript variant alpha, mRNA.
ACCESSION NM_001225
VERSION NM_001225.3 GI:73622123
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1319)
AUTHORS Nickles,D., Falschlehner,C., Metzig,M. and Boutros,M.
TITLE A genome-wide RNA interference screen identifies caspase 4 as a
factor required for tumor necrosis factor alpha signaling
JOURNAL Mol. Cell. Biol. 32 (17), 3372-3381 (2012)
PUBMED 22733992
REMARK GeneRIF: These experiments identify caspase 4 as a novel regulator
of TNF-alpha-induced NF-kappaB signaling that is required for the
activation of I-kappaB kinase.
REFERENCE 2 (bases 1 to 1319)
AUTHORS Sollberger,G., Strittmatter,G.E., Kistowska,M., French,L.E. and
Beer,H.D.
TITLE Caspase-4 is required for activation of inflammasomes
JOURNAL J. Immunol. 188 (4), 1992-2000 (2012)
PUBMED 22246630
REMARK GeneRIF: Caspase-4 expression is essential for efficient
nucleotide-binding domain leucine-rich repeat containing, Pyrin
domain containing-3 and for absent in melanoma 2
inflammasome-dependent proIL-1beta activation in macrophages
REFERENCE 3 (bases 1 to 1319)
AUTHORS Wu,L.F., Ye,Y.Q., Huang,G.Y., Li,H.B., Li,G.P., Pu,Z.J., Wei,B.L.
and Feng,J.L.
TITLE Involvement of endoplasmic reticulum stress in adenosine-induced
human hepatoma HepG2 cell apoptosis
JOURNAL Oncol. Rep. 26 (1), 73-79 (2011)
PUBMED 21479362
REMARK GeneRIF: GRP78, CHOP, caspase 4, and caspase 3 may be involved in
adenosine-induced HepG2 cell apoptosis
REFERENCE 4 (bases 1 to 1319)
AUTHORS Scapoli,L., Girardi,A., Rubini,C., Martinelli,M., Spinelli,G.,
Palmieri,A., Lo Muzio,L. and Carinci,F.
TITLE LOH at PDCD4, CTNNB1, and CASP4 loci contributes to stage
progression of oral cancer
JOURNAL Int J Immunopathol Pharmacol 24 (2 SUPPL), 89-93 (2011)
PUBMED 21781452
REMARK GeneRIF: Loss of heterozygosity contributes to tumor progression of
oral squamous cell carcinoma, and a specific role for PDCD4,
CTNNB1, and CASP4 was found.
REFERENCE 5 (bases 1 to 1319)
AUTHORS Valentin-Acevedo,A., Sinquett,F.L. and Covey,L.R.
TITLE c-Rel deficiency increases caspase-4 expression and leads to ER
stress and necrosis in EBV-transformed cells
JOURNAL PLoS ONE 6 (10), E25467 (2011)
PUBMED 21984918
REMARK GeneRIF: Levels of c-Rel directly modulated expression of caspase-4
as well as other endoplasmic reticulum stress genes.
REFERENCE 6 (bases 1 to 1319)
AUTHORS Srinivasula,S.M., Ahmad,M., Fernandes-Alnemri,T., Litwack,G. and
Alnemri,E.S.
TITLE Molecular ordering of the Fas-apoptotic pathway: the Fas/APO-1
protease Mch5 is a CrmA-inhibitable protease that activates
multiple Ced-3/ICE-like cysteine proteases
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 93 (25), 14486-14491 (1996)
PUBMED 8962078
REFERENCE 7 (bases 1 to 1319)
AUTHORS Munday,N.A., Vaillancourt,J.P., Ali,A., Casano,F.J., Miller,D.K.,
Molineaux,S.M., Yamin,T.T., Yu,V.L. and Nicholson,D.W.
TITLE Molecular cloning and pro-apoptotic activity of ICErelII and
ICErelIII, members of the ICE/CED-3 family of cysteine proteases
JOURNAL J. Biol. Chem. 270 (26), 15870-15876 (1995)
PUBMED 7797592
REFERENCE 8 (bases 1 to 1319)
AUTHORS Kamens,J., Paskind,M., Hugunin,M., Talanian,R.V., Allen,H.,
Banach,D., Bump,N., Hackett,M., Johnston,C.G., Li,P. et al.
TITLE Identification and characterization of ICH-2, a novel member of the
interleukin-1 beta-converting enzyme family of cysteine proteases
JOURNAL J. Biol. Chem. 270 (25), 15250-15256 (1995)
PUBMED 7797510
REFERENCE 9 (bases 1 to 1319)
AUTHORS Faucheu,C., Diu,A., Chan,A.W., Blanchet,A.M., Miossec,C., Herve,F.,
Collard-Dutilleul,V., Gu,Y., Aldape,R.A., Lippke,J.A. et al.
TITLE A novel human protease similar to the interleukin-1 beta converting
enzyme induces apoptosis in transfected cells
JOURNAL EMBO J. 14 (9), 1914-1922 (1995)
PUBMED 7743998
REFERENCE 10 (bases 1 to 1319)
AUTHORS Howard,A.D., Kostura,M.J., Thornberry,N., Ding,G.J., Limjuco,G.,
Weidner,J., Salley,J.P., Hogquist,K.A., Chaplin,D.D., Mumford,R.A.
et al.
TITLE IL-1-converting enzyme requires aspartic acid residues for
processing of the IL-1 beta precursor at two distinct sites and
does not cleave 31-kDa IL-1 alpha
JOURNAL J. Immunol. 147 (9), 2964-2969 (1991)
PUBMED 1919001
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from CN261701.1, Z48810.1 and
AI128358.1.
On Aug 19, 2005 this sequence version replaced gi:15451908.
Summary: This gene encodes a protein that is a member of the
cysteine-aspartic acid protease (caspase) family. Sequential
activation of caspases plays a central role in the execution-phase
of cell apoptosis. Caspases exist as inactive proenzymes composed
of a prodomain and a large and small protease subunit. Activation
of caspases requires proteolytic processing at conserved internal
aspartic residues to generate a heterodimeric enzyme consisting of
the large and small subunits. This caspase is able to cleave and
activate its own precursor protein, as well as caspase 1 precursor.
When overexpressed, this gene induces cell apoptosis. Alternative
splicing results in transcript variants encoding distinct isoforms.
[provided by RefSeq, Jul 2008].
Transcript Variant: This variant (alpha) encodes the longest
isoform (alpha).
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AK057094.1, Z48810.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025088 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-32 CN261701.1 30-61
33-927 Z48810.1 1-895
928-1319 AI128358.1 1-392 c
FEATURES Location/Qualifiers
source 1..1319
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="11"
/map="11q22.2-q22.3"
gene 1..1319
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/note="caspase 4, apoptosis-related cysteine peptidase"
/db_xref="GeneID:837"
/db_xref="HGNC:1505"
/db_xref="HPRD:04047"
/db_xref="MIM:602664"
exon 1..80
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/inference="alignment:Splign:1.39.8"
misc_feature 29..31
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/note="upstream in-frame stop codon"
CDS 74..1207
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/EC_number="3.4.22.57"
/note="isoform alpha precursor is encoded by transcript
variant alpha; apoptotic cysteine protease Mih1/TX;
caspase 4, apoptosis-related cysteine protease; caspase-4;
CASP-4; ICE(rel)-II; protease TX; protease ICH-2"
/codon_start=1
/product="caspase-4 isoform alpha precursor"
/protein_id="NP_001216.1"
/db_xref="GI:4502577"
/db_xref="CCDS:CCDS8327.1"
/db_xref="GeneID:837"
/db_xref="HGNC:1505"
/db_xref="HPRD:04047"
/db_xref="MIM:602664"
/translation="
MAEGNHRKKPLKVLESLGKDFLTGVLDNLVEQNVLNWKEEEKKKYYDAKTEDKVRVMADSMQEKQRMAGQMLLQTFFNIDQISPNKKAHPNMEAGPPESGESTDALKLCPHEEFLRLCKERAEEIYPIKERNNRTRLALIICNTEFDHLPPRNGADFDITGMKELLEGLDYSVDVEENLTARDMESALRAFATRPEHKSSDSTFLVLMSHGILEGICGTVHDEKKPDVLLYDTIFQIFNNRNCLSLKDKPKVIIVQACRGANRGELWVRDSPASLEVASSQSSENLEEDAVYKTHVEKDFIAFCSSTPHNVSWRDSTMGSIFITQLITCFQKYSWCCHLEEVFRKVQQSFETPRAKAQMPTIERLSMTRYFYLFPGN
"
misc_feature 86..316
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/note="Caspase activation and recruitment domain found in
Caspase-1 and related proteins; Region: CARD_CASP1-like;
cd08325"
/db_xref="CDD:176739"
mat_peptide 314..883
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/product="caspase-4 isoform alpha large subunit"
misc_feature 320..322
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
(P49662.1); phosphorylation site"
misc_feature 446..1195
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/note="Caspase, interleukin-1 beta converting enzyme (ICE)
homologues; Cysteine-dependent aspartate-directed
proteases that mediate programmed cell death (apoptosis).
Caspases are synthesized as inactive zymogens and
activated by proteolysis of the peptide...; Region: CASc;
cd00032"
/db_xref="CDD:28914"
misc_feature order(527..529,704..706,839..841,860..862,1004..1021,
1031..1036)
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/note="substrate pocket [chemical binding]; other site"
/db_xref="CDD:28914"
misc_feature order(701..703,845..847)
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/note="active site"
/db_xref="CDD:28914"
misc_feature order(863..865,959..964,983..985,992..994,1001..1003,
1070..1072,1094..1096,1112..1114,1142..1144,1157..1159,
1163..1165,1169..1171,1178..1183)
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/note="dimer interface [polypeptide binding]; other site"
/db_xref="CDD:28914"
misc_feature order(866..868,956..958)
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/note="proteolytic cleavage site; other site"
/db_xref="CDD:28914"
mat_peptide 941..1204
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/product="caspase-4 isoform alpha small subunit"
exon 81..335
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/inference="alignment:Splign:1.39.8"
variation 81
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/replace="a"
/replace="g"
/db_xref="dbSNP:56116531"
variation 117
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/replace="a"
/replace="g"
/db_xref="dbSNP:11539160"
variation 151
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/replace="a"
/replace="g"
/db_xref="dbSNP:55767261"
variation 160
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/replace="a"
/replace="g"
/db_xref="dbSNP:1801319"
variation 161
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/replace="a"
/replace="g"
/db_xref="dbSNP:55725009"
variation 212
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/replace="a"
/replace="g"
/db_xref="dbSNP:56226603"
variation 229
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/replace="c"
/replace="g"
/db_xref="dbSNP:2298768"
exon 336..445
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/inference="alignment:Splign:1.39.8"
exon 446..619
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/inference="alignment:Splign:1.39.8"
exon 620..854
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/inference="alignment:Splign:1.39.8"
variation 691
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/replace="a"
/replace="c"
/db_xref="dbSNP:56326166"
exon 855..998
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/inference="alignment:Splign:1.39.8"
variation 925
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/replace="g"
/replace="t"
/db_xref="dbSNP:55901059"
variation 931
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/replace="a"
/replace="g"
/db_xref="dbSNP:9507"
exon 999..1108
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/inference="alignment:Splign:1.39.8"
variation 1104
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/replace="a"
/replace="g"
/db_xref="dbSNP:56008239"
exon 1109..1212
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/inference="alignment:Splign:1.39.8"
exon 1213..1319
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/inference="alignment:Splign:1.39.8"
polyA_signal 1299..1304
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
variation 1317
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
/replace="c"
/replace="t"
/db_xref="dbSNP:56380626"
polyA_site 1319
/gene="CASP4"
/gene_synonym="ICE(rel)II; ICEREL-II; ICH-2; Mih1/TX; TX"
ORIGIN
atacatagtttactttcatttttgactctgaggctctttccaacgctgtaaaaaaggacagaggctgttccctatggcagaaggcaaccacagaaaaaagccacttaaggtgttggaatccctgggcaaagatttcctcactggtgttttggataacttggtggaacaaaatgtactgaactggaaggaagaggaaaaaaagaaatattacgatgctaaaactgaagacaaagttcgggtcatggcagactctatgcaagagaagcaacgtatggcaggacaaatgcttcttcaaaccttttttaacatagaccaaatatcccccaataaaaaagctcatccgaatatggaggctggaccacctgagtcaggagaatctacagatgccctcaagctttgtcctcatgaagaattcctgagactatgtaaagaaagagctgaagagatctatccaataaaggagagaaacaaccgcacacgcctggctctcatcatatgcaatacagagtttgaccatctgcctccgaggaatggagctgactttgacatcacagggatgaaggagctacttgagggtctggactatagtgtagatgtagaagagaatctgacagccagggatatggagtcagcgctgagggcatttgctaccagaccagagcacaagtcctctgacagcacattcttggtactcatgtctcatggcatcctggagggaatctgcggaactgtgcatgatgagaaaaaaccagatgtgctgctttatgacaccatcttccagatattcaacaaccgcaactgcctcagtctgaaggacaaacccaaggtcatcattgtccaggcctgcagaggtgcaaaccgtggggaactgtgggtcagagactctccagcatccttggaagtggcctcttcacagtcatctgagaacctagaggaagatgctgtttacaagacccacgtggagaaggacttcattgctttctgctcttcaacgccacacaacgtgtcctggagagacagcacaatgggctctatcttcatcacacaactcatcacatgcttccagaaatattcttggtgctgccacctagaggaagtatttcggaaggtacagcaatcatttgaaactccaagggccaaagctcaaatgcccaccatagaacgactgtccatgacaagatatttctacctctttcctggcaattgaaaatggaagccacaagcagcccagccctccttaatcaacttcaaggagcaccttcattagtacagcttgcatatttaacattttgtatttcaataaaagtgaagacaaacga
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:837 -> Molecular function: GO:0004197 [cysteine-type endopeptidase activity] evidence: IEA
GeneID:837 -> Biological process: GO:0006508 [proteolysis] evidence: IEA
GeneID:837 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
GeneID:837 -> Biological process: GO:0006917 [induction of apoptosis] evidence: TAS
GeneID:837 -> Cellular component: GO:0005622 [intracellular] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_001216 -> EC 3.4.22.57
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.