Home |
Help |
Advanced search
2025-05-09 20:29:59, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001139517 1906 bp mRNA linear PRI 07-JUL-2013
DEFINITION Homo sapiens protein kinase, interferon-inducible double stranded
RNA dependent activator (PRKRA), transcript variant 2, mRNA.
ACCESSION NM_001139517
VERSION NM_001139517.1 GI:213417910
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1906)
AUTHORS Redfern,A.D., Colley,S.M., Beveridge,D.J., Ikeda,N., Epis,M.R.,
Li,X., Foulds,C.E., Stuart,L.M., Barker,A., Russell,V.J.,
Ramsay,K., Kobelke,S.J., Li,X., Hatchell,E.C., Payne,C.,
Giles,K.M., Messineo,A., Gatignol,A., Lanz,R.B., O'Malley,B.W. and
Leedman,P.J.
TITLE RNA-induced silencing complex (RISC) Proteins PACT, TRBP, and Dicer
are SRA binding nuclear receptor coregulators
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 110 (16), 6536-6541 (2013)
PUBMED 23550157
REMARK GeneRIF: RISC proteins PACT, TRBP, and Dicer, together with PKR,
are steroid receptor RNA activator-binding nuclear receptor
coregulators that are recruited to the promoters of
hormone-regulated genes and regulate the expression of downstream
target genes.
REFERENCE 2 (bases 1 to 1906)
AUTHORS Mero IL, Gustavsen MW, Saether HS, Flam ST, Berg-Hansen P,
Sondergaard HB, Jensen PE, Berge T, Bjolgerud A, Muggerud A,
Aarseth JH, Myhr KM, Celius EG, Sellebjerg F, Hillert J, Alfredsson
L, Olsson T, Oturai AB, Kockum I, Lie BA, Andreassen BK and Harbo
HF.
CONSRTM International Multiple Sclerosis Genetics Consortium
TITLE Oligoclonal band status in Scandinavian multiple sclerosis patients
is associated with specific genetic risk alleles
JOURNAL PLoS ONE 8 (3), E58352 (2013)
PUBMED 23472185
REFERENCE 3 (bases 1 to 1906)
AUTHORS Zhang,Y.N., Cao,P.P., Zhang,X.H., Lu,X. and Liu,Z.
TITLE Expression of microRNA machinery proteins in different types of
chronic rhinosinusitis
JOURNAL Laryngoscope 122 (12), 2621-2627 (2012)
PUBMED 22961479
REMARK GeneRIF: PACT may be associated with the plasma cell function and
eosinophilic inflammation in CRSwNP.
REFERENCE 4 (bases 1 to 1906)
AUTHORS Sand,M., Skrygan,M., Georgas,D., Arenz,C., Gambichler,T., Sand,D.,
Altmeyer,P. and Bechara,F.G.
TITLE Expression levels of the microRNA maturing microprocessor complex
component DGCR8 and the RNA-induced silencing complex (RISC)
components argonaute-1, argonaute-2, PACT, TARBP1, and TARBP2 in
epithelial skin cancer
JOURNAL Mol. Carcinog. 51 (11), 916-922 (2012)
PUBMED 22025453
REMARK GeneRIF: DGCR8, AGO1, AGO2, PACT, and TARBP1 expression levels were
significantly higher in the epithelial skin cancer groups than the
healthy controls (P > 0.05).
REFERENCE 5 (bases 1 to 1906)
AUTHORS Singh,M. and Patel,R.C.
TITLE Increased interaction between PACT molecules in response to stress
signals is required for PKR activation
JOURNAL J. Cell. Biochem. 113 (8), 2754-2764 (2012)
PUBMED 22473766
REMARK GeneRIF: Data demonstrate that PACT-PACT interaction is essential
for efficient PKR activation.
REFERENCE 6 (bases 1 to 1906)
AUTHORS Horng,T., Barton,G.M. and Medzhitov,R.
TITLE TIRAP: an adapter molecule in the Toll signaling pathway
JOURNAL Nat. Immunol. 2 (9), 835-841 (2001)
PUBMED 11526399
REFERENCE 7 (bases 1 to 1906)
AUTHORS Simpson,J.C., Wellenreuther,R., Poustka,A., Pepperkok,R. and
Wiemann,S.
TITLE Systematic subcellular localization of novel proteins identified by
large-scale cDNA sequencing
JOURNAL EMBO Rep. 1 (3), 287-292 (2000)
PUBMED 11256614
REFERENCE 8 (bases 1 to 1906)
AUTHORS Ito,T., Yang,M. and May,W.S.
TITLE RAX, a cellular activator for double-stranded RNA-dependent protein
kinase during stress signaling
JOURNAL J. Biol. Chem. 274 (22), 15427-15432 (1999)
PUBMED 10336432
REFERENCE 9 (bases 1 to 1906)
AUTHORS Patel,R.C. and Sen,G.C.
TITLE PACT, a protein activator of the interferon-induced protein kinase,
PKR
JOURNAL EMBO J. 17 (15), 4379-4390 (1998)
PUBMED 9687506
REFERENCE 10 (bases 1 to 1906)
AUTHORS Simons,A., Melamed-Bessudo,C., Wolkowicz,R., Sperling,J.,
Sperling,R., Eisenbach,L. and Rotter,V.
TITLE PACT: cloning and characterization of a cellular p53 binding
protein that interacts with Rb
JOURNAL Oncogene 14 (2), 145-155 (1997)
PUBMED 9010216
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AL833867.1 and AC009948.3.
Summary: This gene encodes a protein kinase activated by
double-stranded RNA which mediates the effects of interferon in
response to viral infection. Mutations in this gene have been
associated with dystonia. Alternative splicing results in multiple
transcript variants. [provided by RefSeq, Nov 2008].
Transcript Variant: This variant (2) differs in the 5' UTR,
compared to variant 1. This difference causes translation
initiation at a downstream AUG and an isoform (2) with a shorter
N-terminus compared to isoform 1.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AL833867.1, BI333091.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-1898 AL833867.1 1-1898
1899-1906 AC009948.3 38004-38011 c
FEATURES Location/Qualifiers
source 1..1906
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="2"
/map="2q31.2"
gene 1..1906
/gene="PRKRA"
/gene_synonym="DYT16; HSD14; PACT; RAX"
/note="protein kinase, interferon-inducible double
stranded RNA dependent activator"
/db_xref="GeneID:8575"
/db_xref="HGNC:9438"
/db_xref="MIM:603424"
exon 1..516
/gene="PRKRA"
/gene_synonym="DYT16; HSD14; PACT; RAX"
/inference="alignment:Splign:1.39.8"
misc_feature 273..275
/gene="PRKRA"
/gene_synonym="DYT16; HSD14; PACT; RAX"
/note="upstream in-frame stop codon"
CDS 315..1223
/gene="PRKRA"
/gene_synonym="DYT16; HSD14; PACT; RAX"
/note="isoform 2 is encoded by transcript variant 2;
protein activator of the interferon-induced protein
kinase; interferon-inducible double stranded RNA-dependent
protein kinase activator A; protein kinase,
interferon-inducible double stranded RNA-dependent
activator; PKR-associated protein X; PKR-associating
protein X"
/codon_start=1
/product="interferon-inducible double stranded
RNA-dependent protein kinase activator A isoform 2"
/protein_id="NP_001132989.1"
/db_xref="GI:213417911"
/db_xref="CCDS:CCDS46460.1"
/db_xref="GeneID:8575"
/db_xref="HGNC:9438"
/db_xref="MIM:603424"
/translation="
MQSTPFCGFCSLGKMITAKPGKTPIQVLHEYGMKTKNIPVYECERSDVQIHVPTFTFRVTVGDITCTGEGTSKKLAKHRAAEAAINILKANASICFAVPDPLMPDPSKQPKNQLNPIGSLQELAIHHGWRLPEYTLSQEGGPAHKREYTTICRLESFMETGKGASKKQAKRNAAEKFLAKFSNISPENHISLTNVVGHSLGCTWHSLRNSPGEKINLLKRSLLSIPNTDYIQLLSEIAKEQGFNITYLDIDELSANGQYQCLAELSTSPITVCHGSGISCGNAQSDAAHNALQYLKIIAERK
"
misc_feature 381..578
/gene="PRKRA"
/gene_synonym="DYT16; HSD14; PACT; RAX"
/note="Double-stranded RNA binding motif. Binding is not
sequence specific but is highly specific for double
stranded RNA. Found in a variety of proteins including
dsRNA dependent protein kinase PKR, RNA helicases,
Drosophila staufen protein, E. coli RNase III; Region:
DSRM; cd00048"
/db_xref="CDD:28930"
misc_feature order(381..383,399..404,525..536,543..545)
/gene="PRKRA"
/gene_synonym="DYT16; HSD14; PACT; RAX"
/note="dsRNA binding site [nucleotide binding]; other
site"
/db_xref="CDD:28930"
misc_feature 657..857
/gene="PRKRA"
/gene_synonym="DYT16; HSD14; PACT; RAX"
/note="Double-stranded RNA binding motif. Binding is not
sequence specific but is highly specific for double
stranded RNA. Found in a variety of proteins including
dsRNA dependent protein kinase PKR, RNA helicases,
Drosophila staufen protein, E. coli RNase III; Region:
DSRM; cd00048"
/db_xref="CDD:28930"
misc_feature order(657..659,675..680,804..815,822..824)
/gene="PRKRA"
/gene_synonym="DYT16; HSD14; PACT; RAX"
/note="dsRNA binding site [nucleotide binding]; other
site"
/db_xref="CDD:28930"
misc_feature 999..1199
/gene="PRKRA"
/gene_synonym="DYT16; HSD14; PACT; RAX"
/note="Double-stranded RNA binding motif. Binding is not
sequence specific but is highly specific for double
stranded RNA. Found in a variety of proteins including
dsRNA dependent protein kinase PKR, RNA helicases,
Drosophila staufen protein, E. coli RNase III; Region:
DSRM; cd00048"
/db_xref="CDD:28930"
misc_feature order(999..1001,1017..1022,1146..1157,1164..1166)
/gene="PRKRA"
/gene_synonym="DYT16; HSD14; PACT; RAX"
/note="dsRNA binding site [nucleotide binding]; other
site"
/db_xref="CDD:28930"
exon 517..598
/gene="PRKRA"
/gene_synonym="DYT16; HSD14; PACT; RAX"
/inference="alignment:Splign:1.39.8"
exon 599..677
/gene="PRKRA"
/gene_synonym="DYT16; HSD14; PACT; RAX"
/inference="alignment:Splign:1.39.8"
exon 678..795
/gene="PRKRA"
/gene_synonym="DYT16; HSD14; PACT; RAX"
/inference="alignment:Splign:1.39.8"
exon 796..890
/gene="PRKRA"
/gene_synonym="DYT16; HSD14; PACT; RAX"
/inference="alignment:Splign:1.39.8"
exon 891..1065
/gene="PRKRA"
/gene_synonym="DYT16; HSD14; PACT; RAX"
/inference="alignment:Splign:1.39.8"
variation 958
/gene="PRKRA"
/gene_synonym="DYT16; HSD14; PACT; RAX"
/replace="a"
/replace="t"
/db_xref="dbSNP:77419724"
exon 1066..1906
/gene="PRKRA"
/gene_synonym="DYT16; HSD14; PACT; RAX"
/inference="alignment:Splign:1.39.8"
STS 1094..1176
/gene="PRKRA"
/gene_synonym="DYT16; HSD14; PACT; RAX"
/standard_name="D2S1579E"
/db_xref="UniSTS:150663"
variation 1226
/gene="PRKRA"
/gene_synonym="DYT16; HSD14; PACT; RAX"
/replace="c"
/replace="t"
/db_xref="dbSNP:3997876"
variation 1381
/gene="PRKRA"
/gene_synonym="DYT16; HSD14; PACT; RAX"
/replace="a"
/replace="g"
/db_xref="dbSNP:3997877"
variation 1421
/gene="PRKRA"
/gene_synonym="DYT16; HSD14; PACT; RAX"
/replace="c"
/replace="t"
/db_xref="dbSNP:3997878"
variation 1536
/gene="PRKRA"
/gene_synonym="DYT16; HSD14; PACT; RAX"
/replace="a"
/replace="g"
/db_xref="dbSNP:3997879"
STS 1667..1771
/gene="PRKRA"
/gene_synonym="DYT16; HSD14; PACT; RAX"
/standard_name="A005Y08"
/db_xref="UniSTS:56816"
STS 1667..1771
/gene="PRKRA"
/gene_synonym="DYT16; HSD14; PACT; RAX"
/standard_name="G20590"
/db_xref="UniSTS:56815"
STS 1668..1787
/gene="PRKRA"
/gene_synonym="DYT16; HSD14; PACT; RAX"
/standard_name="RH47285"
/db_xref="UniSTS:86244"
ORIGIN
gcggggcgggcggaggtgacgctcggtcggcgcgcccgggaagggatcgtcaggttttccctgagaggctgcggcgctgctgccagccctgttctgttgagaatctctcctacccgcattcaagtgctctctctaaagacctcgctcaccccgcctgctcctgcggagtgactgccgcagcggggccggaagacaggtgcgccccagcctcgccagctctggccctggcctccggggaactcggcgcctccctcgtcaccgtcggtggcggttaaaactggcctctacgcttctgcttcaatctccaatttggcatgcaaagcacacctttttgtggtttttgcagtttggggaagatgataacagctaagccagggaaaacaccgattcaggtattacacgaatacggcatgaagaccaagaacatcccagtttatgaatgtgaaagatctgatgtgcaaatacacgtgcccactttcaccttcagagtaaccgttggtgacataacctgcacaggtgaaggtacaagtaagaagctggcgaaacatagagctgcagaggctgccataaacattttgaaagccaatgcaagtatttgctttgcagttcctgaccccttaatgcctgacccttccaagcaaccaaagaaccagcttaatcctattggttcattacaggaattggctattcatcatggctggagacttcctgaatataccctttcccaggagggaggacctgctcataagagagaatatactacaatttgcaggctagagtcatttatggaaactggaaagggggcatcaaaaaagcaagccaaaaggaatgctgctgagaaatttcttgccaaatttagtaatatttctccagagaaccacatttctttaacaaatgtagtaggacattctttaggatgtacttggcattccttgaggaattctcctggtgaaaagatcaacttactgaaaagaagcctccttagtattccaaatacagattacatccagctgcttagtgaaattgccaaggaacaaggttttaatataacatatttggatatagatgaactgagcgccaatggacaatatcaatgtcttgctgaactgtccaccagccccatcacagtctgtcatggctccggtatctcctgtggcaatgcacaaagtgatgcagctcacaatgctttgcagtatttaaagataatagcagaaagaaagtaaatctggagcaacttaaaaaatctttcagtagcacataaaaagttcccctctggccccttcccaagtaaaacttttaccgtagtgtttatgtcttgtttctaaatctcttcatagattccatcaacactccagatttaattatctcctcatagttgttattaagctctttttaatggcttcaactttgtatcagtatactgtatttataaactttgtaccacaagagagagtgtagcacccattttacagtgccatgcacatcagagaaagaaactgcatgtttgttgttgatgatgaaataaaaatgctagcgacagtctttcttactggtgcttaagctcttctttgcacaaagctttataaagggaattcaaaggaagccctttagaattagagtcttgagggacagcactaacaggcctttattaagtatgattgattgttaaatttcagggaacatgattggtctgctgtgtatttgaattcatgtaacaaagaactgttacgatgggattctgctcattttattaaaaagctactgacttgactgtcatcctgttcttgttagccattgtgaataagattttaatgttgataattctgttatttacatatctctaatttactttgaaattcaaaggtgaaaataaaaaatgatggcctaagtaaaatttacaaacata
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:8575 -> Molecular function: GO:0003723 [RNA binding] evidence: IEA
GeneID:8575 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:8575 -> Molecular function: GO:0008047 [enzyme activator activity] evidence: TAS
GeneID:8575 -> Molecular function: GO:0042803 [protein homodimerization activity] evidence: IPI
GeneID:8575 -> Biological process: GO:0006468 [protein phosphorylation] evidence: IEA
GeneID:8575 -> Biological process: GO:0006917 [induction of apoptosis] evidence: IEA
GeneID:8575 -> Biological process: GO:0006950 [response to stress] evidence: IEA
GeneID:8575 -> Biological process: GO:0006955 [immune response] evidence: TAS
GeneID:8575 -> Biological process: GO:0008285 [negative regulation of cell proliferation] evidence: TAS
GeneID:8575 -> Biological process: GO:0009615 [response to virus] evidence: TAS
GeneID:8575 -> Biological process: GO:0010467 [gene expression] evidence: TAS
GeneID:8575 -> Biological process: GO:0030422 [production of siRNA involved in RNA interference] evidence: IDA
GeneID:8575 -> Biological process: GO:0042473 [outer ear morphogenesis] evidence: IEA
GeneID:8575 -> Biological process: GO:0042474 [middle ear morphogenesis] evidence: IEA
GeneID:8575 -> Biological process: GO:0043085 [positive regulation of catalytic activity] evidence: TAS
GeneID:8575 -> Biological process: GO:0048705 [skeletal system morphogenesis] evidence: IEA
GeneID:8575 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:8575 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:8575 -> Cellular component: GO:0048471 [perinuclear region of cytoplasm] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.