Home |
Help |
Advanced search
2025-05-09 19:33:28, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_000888 2397 bp mRNA linear PRI 14-MAY-2013
DEFINITION Homo sapiens integrin, beta 6 (ITGB6), mRNA.
ACCESSION NM_000888
VERSION NM_000888.3 GI:9966771
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2397)
AUTHORS Hezel,A.F., Deshpande,V., Zimmerman,S.M., Contino,G., Alagesan,B.,
O'Dell,M.R., Rivera,L.B., Harper,J., Lonning,S., Brekken,R.A. and
Bardeesy,N.
TITLE TGF-beta and alphavbeta6 integrin act in a common pathway to
suppress pancreatic cancer progression
JOURNAL Cancer Res. 72 (18), 4840-4845 (2012)
PUBMED 22787119
REMARK GeneRIF: our findings indicate that alphavbeta6 and TGF-beta act in
a common tumor suppressor pathway
REFERENCE 2 (bases 1 to 2397)
AUTHORS Yang,S.B., Du,Y., Wu,B.Y., Xu,S.P., Wen,J.B., Zhu,M., Cai,C.H. and
Yang,P.C.
TITLE Integrin alphavbeta6 promotes tumor tolerance in colorectal cancer
JOURNAL Cancer Immunol. Immunother. 61 (3), 335-342 (2012)
PUBMED 21913024
REMARK GeneRIF: Data suggest that colorectal cancer (CRC)-derived integrin
alphavbeta6 is involved in the establishment of tumor immune
tolerance in local tissues.
REFERENCE 3 (bases 1 to 2397)
AUTHORS Lee,C.N., Heidbrink,J.L., McKinnon,K., Bushman,V., Olsen,H.,
FitzHugh,W., Li,A., Van Orden,K., He,T., Ruben,S.M. and Moore,P.A.
TITLE RNA interference characterization of proteins discovered by
proteomic analysis of pancreatic cancer reveals function in cell
growth and survival
JOURNAL Pancreas 41 (1), 84-94 (2012)
PUBMED 21934552
REMARK GeneRIF: Data indicate that integrin beta6, CD46, tissue factor,
and chromosome 14 open reading frame 1 (C14ORF1), were identified
as overexpressed on pancreatic cancer cell lines.
REFERENCE 4 (bases 1 to 2397)
AUTHORS Defilles,C., Montero,M.P., Lissitzky,J.C., Rome,S., Siret,C.,
Luis,J., Andre,F. and Rigot,V.
TITLE alphav integrin processing interferes with the cross-talk between
alphavbeta5/beta6 and alpha2beta1 integrins
JOURNAL Biol. Cell 103 (11), 519-529 (2011)
PUBMED 21787362
REMARK GeneRIF: The endoproteolytic cleavage of alphav subunits is
necessary for alphavbeta5/beta6 integrin to control alpha2beta1
function and could thus play an essential role in colon cancer cell
migration.
REFERENCE 5 (bases 1 to 2397)
AUTHORS Stanescu,H.C., Arcos-Burgos,M., Medlar,A., Bockenhauer,D.,
Kottgen,A., Dragomirescu,L., Voinescu,C., Patel,N., Pearce,K.,
Hubank,M., Stephens,H.A., Laundy,V., Padmanabhan,S., Zawadzka,A.,
Hofstra,J.M., Coenen,M.J., den Heijer,M., Kiemeney,L.A.,
Bacq-Daian,D., Stengel,B., Powis,S.H., Brenchley,P., Feehally,J.,
Rees,A.J., Debiec,H., Wetzels,J.F., Ronco,P., Mathieson,P.W. and
Kleta,R.
TITLE Risk HLA-DQA1 and PLA(2)R1 alleles in idiopathic membranous
nephropathy
JOURNAL N. Engl. J. Med. 364 (7), 616-626 (2011)
PUBMED 21323541
REFERENCE 6 (bases 1 to 2397)
AUTHORS Weinacker,A., Ferrando,R., Elliott,M., Hogg,J., Balmes,J. and
Sheppard,D.
TITLE Distribution of integrins alpha v beta 6 and alpha 9 beta 1 and
their known ligands, fibronectin and tenascin, in human airways
JOURNAL Am. J. Respir. Cell Mol. Biol. 12 (5), 547-556 (1995)
PUBMED 7537970
REFERENCE 7 (bases 1 to 2397)
AUTHORS Jiang,W.M., Jenkins,D., Yuan,Q., Leung,E., Choo,K.H., Watson,J.D.
and Krissansen,G.W.
TITLE The gene organization of the human beta 7 subunit, the common beta
subunit of the leukocyte integrins HML-1 and LPAM-1
JOURNAL Int. Immunol. 4 (9), 1031-1040 (1992)
PUBMED 1382574
REFERENCE 8 (bases 1 to 2397)
AUTHORS Busk,M., Pytela,R. and Sheppard,D.
TITLE Characterization of the integrin alpha v beta 6 as a
fibronectin-binding protein
JOURNAL J. Biol. Chem. 267 (9), 5790-5796 (1992)
PUBMED 1532572
REFERENCE 9 (bases 1 to 2397)
AUTHORS Krissansen,G.W., Yuan,Q., Jenkins,D., Jiang,W.M., Rooke,L.,
Spurr,N.K., Eccles,M., Leung,E. and Watson,J.D.
TITLE Chromosomal locations of the genes coding for the integrin beta 6
and beta 7 subunits
JOURNAL Immunogenetics 35 (1), 58-61 (1992)
PUBMED 1729173
REFERENCE 10 (bases 1 to 2397)
AUTHORS Sheppard,D., Rozzo,C., Starr,L., Quaranta,V., Erle,D.J. and
Pytela,R.
TITLE Complete amino acid sequence of a novel integrin beta subunit (beta
6) identified in epithelial cells using the polymerase chain
reaction
JOURNAL J. Biol. Chem. 265 (20), 11502-11507 (1990)
PUBMED 2365683
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. The reference sequence was derived from M35198.3.
On Sep 5, 2000 this sequence version replaced gi:9625001.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: M35198.3, BC121178.2 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025083, ERS025084 [ECO:0000350]
##Evidence-Data-END##
FEATURES Location/Qualifiers
source 1..2397
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="2"
/map="2q24.2"
gene 1..2397
/gene="ITGB6"
/note="integrin, beta 6"
/db_xref="GeneID:3694"
/db_xref="HGNC:6161"
/db_xref="HPRD:00947"
/db_xref="MIM:147558"
exon 1..77
/gene="ITGB6"
/inference="alignment:Splign:1.39.8"
variation complement(7)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:199606196"
CDS 17..2383
/gene="ITGB6"
/note="integrin beta-6"
/codon_start=1
/product="integrin beta-6 precursor"
/protein_id="NP_000879.2"
/db_xref="GI:9625002"
/db_xref="CCDS:CCDS2212.1"
/db_xref="GeneID:3694"
/db_xref="HGNC:6161"
/db_xref="HPRD:00947"
/db_xref="MIM:147558"
/translation="
MGIELLCLFFLFLGRNDHVQGGCALGGAETCEDCLLIGPQCAWCAQENFTHPSGVGERCDTPANLLAKGCQLNFIENPVSQVEILKNKPLSVGRQKNSSDIVQIAPQSLILKLRPGGAQTLQVHVRQTEDYPVDLYYLMDLSASMDDDLNTIKELGSRLSKEMSKLTSNFRLGFGSFVEKPVSPFVKTTPEEIANPCSSIPYFCLPTFGFKHILPLTNDAERFNEIVKNQKISANIDTPEGGFDAIMQAAVCKEKIGWRNDSLHLLVFVSDADSHFGMDSKLAGIVIPNDGLCHLDSKNEYSMSTVLEYPTIGQLIDKLVQNNVLLIFAVTQEQVHLYENYAKLIPGATVGLLQKDSGNILQLIISAYEELRSEVELEVLGDTEGLNLSFTAICNNGTLFQHQKKCSHMKVGDTASFSVTVNIPHCERRSRHIIIKPVGLGDALELLVSPECNCDCQKEVEVNSSKCHHGNGSFQCGVCACHPGHMGPRCECGEDMLSTDSCKEAPDHPSCSGRGDCYCGQCICHLSPYGNIYGPYCQCDNFSCVRHKGLLCGGNGDCDCGECVCRSGWTGEYCNCTTSTDSCVSEDGVLCSGRGDCVCGKCVCTNPGASGPTCERCPTCGDPCNSKRSCIECHLSAAGQAREECVDKCKLAGATISEEEDFSKDGSVSCSLQGENECLITFLITTDNEGKTIIHSINEKDCPKPPNIPMIMLGVSLAILLIGVVLLCIWKLLVSFHDRKEVAKFEAERSKAKWQTGTNPLYRGSTSTFKNVTYKHREKQKVDLSTDC
"
sig_peptide 17..79
/gene="ITGB6"
/inference="COORDINATES: ab initio prediction:SignalP:4.0"
mat_peptide 80..2380
/gene="ITGB6"
/product="Integrin beta-6"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P18564.2)"
misc_feature 104..1378
/gene="ITGB6"
/note="Integrin, beta chain; Region: Integrin_beta;
pfam00362"
/db_xref="CDD:201181"
misc_feature 1382..1873
/gene="ITGB6"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P18564.2);
Region: Cysteine-rich tandem repeats"
misc_feature 1886..2137
/gene="ITGB6"
/note="Integrin beta tail domain; Region: Integrin_B_tail;
pfam07965"
/db_xref="CDD:149183"
misc_feature 2144..2206
/gene="ITGB6"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (P18564.2);
transmembrane region"
misc_feature 2207..2344
/gene="ITGB6"
/note="Integrin beta cytoplasmic domain; Region:
Integrin_b_cyt; pfam08725"
/db_xref="CDD:149701"
misc_feature 2207..2290
/gene="ITGB6"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (P18564.2);
Region: Interaction with HAX1"
variation complement(23)
/gene="ITGB6"
/replace="a"
/replace="t"
/db_xref="dbSNP:142866134"
variation complement(25)
/gene="ITGB6"
/replace="a"
/replace="t"
/db_xref="dbSNP:139568469"
variation complement(49)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:373761580"
variation complement(56)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:370341448"
variation complement(60)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:188990572"
variation complement(62)
/gene="ITGB6"
/replace="a"
/replace="c"
/db_xref="dbSNP:144155990"
variation complement(70)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:149306240"
exon 78..157
/gene="ITGB6"
/inference="alignment:Splign:1.39.8"
variation complement(141)
/gene="ITGB6"
/replace="c"
/replace="g"
/db_xref="dbSNP:150547491"
exon 158..362
/gene="ITGB6"
/inference="alignment:Splign:1.39.8"
variation complement(166)
/gene="ITGB6"
/replace="g"
/replace="t"
/db_xref="dbSNP:201087444"
variation complement(172)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:202016962"
variation complement(183)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:143336326"
variation complement(184)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:199924562"
variation complement(208)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:139380804"
variation complement(209)
/gene="ITGB6"
/replace="c"
/replace="g"
/db_xref="dbSNP:369726068"
variation complement(241)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:370588403"
variation complement(286)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:367963732"
variation complement(287)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:374377727"
variation complement(290)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:200784593"
variation complement(306)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:375627531"
variation complement(330)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:61758143"
variation complement(331)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:140575384"
variation complement(345)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:371257499"
exon 363..609
/gene="ITGB6"
/inference="alignment:Splign:1.39.8"
variation complement(397)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:143559183"
variation complement(404)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:373385870"
variation complement(411)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:369275471"
variation complement(412)
/gene="ITGB6"
/replace="g"
/replace="t"
/db_xref="dbSNP:201700153"
STS 433..1342
/gene="ITGB6"
/standard_name="Itgb6"
/db_xref="UniSTS:507377"
variation complement(443)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:140015315"
variation complement(457)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:61758144"
variation complement(484)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:143995509"
variation complement(502)
/gene="ITGB6"
/replace="g"
/replace="t"
/db_xref="dbSNP:147372514"
variation complement(529)
/gene="ITGB6"
/replace="a"
/replace="t"
/db_xref="dbSNP:377415826"
variation complement(533)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:373088517"
variation complement(543)
/gene="ITGB6"
/replace="a"
/replace="c"
/db_xref="dbSNP:369951064"
variation complement(560)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:142717768"
variation complement(572)
/gene="ITGB6"
/replace="g"
/replace="t"
/db_xref="dbSNP:375472275"
variation complement(608)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:372144143"
exon 610..775
/gene="ITGB6"
/inference="alignment:Splign:1.39.8"
variation complement(620)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:374721403"
variation complement(625)
/gene="ITGB6"
/replace="c"
/replace="g"
/db_xref="dbSNP:372264340"
variation complement(646)
/gene="ITGB6"
/replace="a"
/replace="c"
/db_xref="dbSNP:367990097"
variation complement(661)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:141975569"
variation complement(687)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:373488084"
variation complement(733)
/gene="ITGB6"
/replace="c"
/replace="g"
/db_xref="dbSNP:61737769"
variation complement(734)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:140624114"
variation complement(751)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:140101986"
variation complement(758)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:369609347"
exon 776..937
/gene="ITGB6"
/inference="alignment:Splign:1.39.8"
variation complement(791)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:149747755"
variation complement(799)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:2305818"
variation complement(815)
/gene="ITGB6"
/replace="c"
/replace="g"
/db_xref="dbSNP:139649173"
variation complement(835)
/gene="ITGB6"
/replace="a"
/replace="t"
/db_xref="dbSNP:61737770"
variation complement(860)
/gene="ITGB6"
/replace="c"
/replace="g"
/db_xref="dbSNP:143852527"
variation complement(887)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:144253582"
variation complement(903)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:188645370"
variation complement(932)
/gene="ITGB6"
/replace="c"
/replace="g"
/db_xref="dbSNP:371374688"
exon 938..1033
/gene="ITGB6"
/inference="alignment:Splign:1.39.8"
variation complement(958)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:376927196"
variation complement(985)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:138313490"
variation complement(1000)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:376000676"
variation complement(1006)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:188012212"
variation complement(1014)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:142185271"
exon 1034..1123
/gene="ITGB6"
/inference="alignment:Splign:1.39.8"
variation complement(1035)
/gene="ITGB6"
/replace="a"
/replace="c"
/db_xref="dbSNP:113506485"
variation complement(1040)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:140967203"
variation complement(1046)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:148922939"
variation complement(1087)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:377379137"
variation complement(1120)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:373093213"
exon 1124..1258
/gene="ITGB6"
/inference="alignment:Splign:1.39.8"
variation complement(1136)
/gene="ITGB6"
/replace="g"
/replace="t"
/db_xref="dbSNP:181269473"
variation complement(1162)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:372093084"
variation complement(1183)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:201712748"
variation complement(1191)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:374723421"
variation complement(1204)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:147650138"
variation complement(1236)
/gene="ITGB6"
/replace="a"
/replace="c"
/db_xref="dbSNP:147811874"
exon 1259..1676
/gene="ITGB6"
/inference="alignment:Splign:1.39.8"
variation complement(1270)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:144315908"
variation complement(1273)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:1156821"
variation complement(1280)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:201585236"
variation complement(1315)
/gene="ITGB6"
/replace="g"
/replace="t"
/db_xref="dbSNP:61748239"
variation complement(1325)
/gene="ITGB6"
/replace="a"
/replace="c"
/db_xref="dbSNP:2305820"
variation complement(1328)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:61737764"
variation complement(1365)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:368470620"
variation complement(1378)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:371228674"
variation complement(1379)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:201552904"
variation complement(1385)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:200295975"
variation complement(1405)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:41264219"
variation complement(1421)
/gene="ITGB6"
/replace="a"
/replace="c"
/db_xref="dbSNP:142197545"
variation complement(1423)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:376134860"
variation complement(1424)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:55841905"
variation complement(1425)
/gene="ITGB6"
/replace="g"
/replace="t"
/db_xref="dbSNP:148881693"
variation complement(1429)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:146684598"
variation complement(1440)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:373568907"
variation complement(1472)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:147011033"
variation 1476
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:193920975"
variation complement(1478)
/gene="ITGB6"
/replace="a"
/replace="c"
/db_xref="dbSNP:147828856"
variation complement(1482)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:369831997"
variation complement(1496)
/gene="ITGB6"
/replace="c"
/replace="g"
/db_xref="dbSNP:374801905"
variation complement(1507)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:201873845"
variation complement(1509)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:372571486"
variation complement(1553)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:199564092"
variation complement(1561)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:201630297"
variation complement(1593)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:184765465"
variation complement(1611)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:376026402"
variation complement(1648)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:61737765"
variation complement(1649)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:144967638"
variation complement(1663)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:192649370"
variation complement(1667)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:144680666"
variation complement(1672)
/gene="ITGB6"
/replace="a"
/replace="c"
/db_xref="dbSNP:139038668"
variation complement(1673)
/gene="ITGB6"
/replace="g"
/replace="t"
/db_xref="dbSNP:188076755"
exon 1677..1899
/gene="ITGB6"
/inference="alignment:Splign:1.39.8"
variation complement(1685)
/gene="ITGB6"
/replace="g"
/replace="t"
/db_xref="dbSNP:143914557"
variation complement(1690)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:199737317"
variation complement(1729)
/gene="ITGB6"
/replace="c"
/replace="g"
/db_xref="dbSNP:2305819"
variation complement(1730)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:144758639"
variation complement(1744)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:368487211"
variation complement(1756)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:201047218"
variation complement(1793)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:200492977"
variation complement(1863)
/gene="ITGB6"
/replace="c"
/replace="g"
/db_xref="dbSNP:144493660"
variation complement(1898)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:202195621"
exon 1900..1997
/gene="ITGB6"
/inference="alignment:Splign:1.39.8"
variation complement(1908)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:370714170"
variation complement(1916)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:142919023"
variation complement(1917)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:150163379"
variation complement(1926)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:376329044"
variation complement(1937)
/gene="ITGB6"
/replace="g"
/replace="t"
/db_xref="dbSNP:200972517"
variation complement(1940)
/gene="ITGB6"
/replace="a"
/replace="c"
/db_xref="dbSNP:61737767"
variation complement(1941)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:200145370"
variation complement(1977)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:150971153"
variation complement(1978)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:201818641"
exon 1998..2117
/gene="ITGB6"
/inference="alignment:Splign:1.39.8"
variation complement(2018)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:376470109"
variation complement(2036)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:200660753"
variation complement(2074)
/gene="ITGB6"
/replace="a"
/replace="c"
/db_xref="dbSNP:199673949"
variation complement(2080)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:16844790"
variation complement(2096)
/gene="ITGB6"
/replace="a"
/replace="t"
/db_xref="dbSNP:139804091"
variation complement(2098)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:373773195"
exon 2118..2284
/gene="ITGB6"
/inference="alignment:Splign:1.39.8"
variation complement(2124)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:369122182"
variation complement(2135)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:377135299"
variation complement(2147)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:372646338"
variation complement(2151)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:367865998"
variation complement(2186)
/gene="ITGB6"
/replace="c"
/replace="g"
/db_xref="dbSNP:146397669"
variation complement(2216)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:374327754"
variation complement(2251)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:370595727"
variation complement(2261)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:199651918"
variation complement(2283)
/gene="ITGB6"
/replace="c"
/replace="t"
/db_xref="dbSNP:150867142"
exon 2285..2397
/gene="ITGB6"
/inference="alignment:Splign:1.39.8"
variation complement(2287)
/gene="ITGB6"
/replace="a"
/replace="g"
/db_xref="dbSNP:202190549"
variation complement(2339)
/gene="ITGB6"
/replace="a"
/replace="t"
/db_xref="dbSNP:201494177"
ORIGIN
gcaagaactgaaacgaatggggattgaactgctttgcctgttctttctatttctaggaaggaatgatcacgtacaaggtggctgtgccctgggaggtgcagaaacctgtgaagactgcctgcttattggacctcagtgtgcctggtgtgctcaggagaattttactcatccatctggagttggcgaaaggtgtgataccccagcaaaccttttagctaaaggatgtcaattaaacttcatcgaaaaccctgtctcccaagtagaaatacttaaaaataagcctctcagtgtaggcagacagaaaaatagttctgacattgttcagattgcgcctcaaagcttgatccttaagttgagaccaggtggtgcgcagactctgcaggtgcatgtccgccagactgaggactacccggtggatttgtattacctcatggacctctccgcctccatggatgacgacctcaacacaataaaggagctgggctcccggctttccaaagagatgtctaaattaaccagcaactttagactgggcttcggatcttttgtggaaaaacctgtatcccctttcgtgaaaacaacaccagaagaaattgccaacccttgcagtagtattccatacttctgtttacctacatttggattcaagcacattttgccattgacaaatgatgctgaaagattcaatgaaattgtgaagaatcagaaaatttctgctaatattgacacacccgaaggtggatttgatgcaattatgcaagctgctgtgtgtaaggaaaaaattggctggcggaatgactccctccacctcctggtctttgtgagtgatgctgattctcattttggaatggacagcaaactagcaggcatcgtcattcctaatgacgggctctgtcacttggacagcaagaatgaatactccatgtcaactgtcttggaatatccaacaattggacaactcattgataaactggtacaaaacaacgtgttattgatcttcgctgtaacccaagaacaagttcatttatatgagaattacgcaaaacttattcctggagctacagtaggtctacttcagaaggactccggaaacattctccagctgatcatctcagcttatgaagaactgcggtctgaggtggaactggaagtattaggagacactgaaggactcaacttgtcatttacagccatctgtaacaacggtaccctcttccaacaccaaaagaaatgctctcacatgaaagtgggagacacagcttccttcagcgtgactgtgaatatcccacactgcgagagaagaagcaggcacattatcataaagcctgtggggctgggggatgccctggaattacttgtcagcccagaatgcaactgcgactgtcagaaagaagtggaagtgaacagctccaaatgtcaccacgggaacggctctttccagtgtggggtgtgtgcctgccaccctggccacatggggcctcgctgtgagtgtggcgaggacatgctgagcacagattcctgcaaggaggccccagatcatccctcctgcagcggaaggggtgactgctactgtgggcagtgtatctgccacttgtctccctatggaaacatttatgggccttattgccagtgtgacaatttctcctgcgtgagacacaaagggctgctctgcggaggtaacggcgactgtgactgtggtgaatgtgtgtgcaggagcggctggactggcgagtactgcaactgcaccaccagcacggactcctgcgtctctgaagatggagtgctctgcagcgggcgcggggactgtgtttgtggcaagtgtgtttgcacaaaccctggagcctcaggaccaacctgtgaacgatgtcctacctgtggtgacccctgtaactctaaacggagctgcattgagtgccacctgtcagcagctggccaagcccgagaagaatgtgtggacaagtgcaaactagctggtgcgaccatcagtgaagaagaagatttctcaaaggatggttctgtttcctgctctctgcaaggagaaaatgaatgtcttattacattcctaataactacagataatgaggggaaaaccatcattcacagcatcaatgaaaaagattgtccgaagcctccaaacattcccatgatcatgttaggggtttccctggctattcttctcatcggggttgtcctactgtgcatctggaagctactggtgtcatttcatgatcgtaaagaagttgccaaatttgaagcagaacgatcaaaagccaagtggcaaacgggaaccaatccactctacagaggatccacaagtacttttaaaaatgtaacttataaacacagggaaaaacaaaaggtagacctttccacagattgctagaactactttatgca
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:3694 -> Molecular function: GO:0004872 [receptor activity] evidence: IEA
GeneID:3694 -> Molecular function: GO:0005178 [integrin binding] evidence: IEA
GeneID:3694 -> Biological process: GO:0006954 [inflammatory response] evidence: IEA
GeneID:3694 -> Biological process: GO:0007155 [cell adhesion] evidence: TAS
GeneID:3694 -> Biological process: GO:0007160 [cell-matrix adhesion] evidence: IEA
GeneID:3694 -> Biological process: GO:0007229 [integrin-mediated signaling pathway] evidence: IEA
GeneID:3694 -> Biological process: GO:0007275 [multicellular organismal development] evidence: IEA
GeneID:3694 -> Biological process: GO:0019048 [modulation by virus of host morphology or physiology] evidence: IEA
GeneID:3694 -> Biological process: GO:0030198 [extracellular matrix organization] evidence: TAS
GeneID:3694 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
GeneID:3694 -> Cellular component: GO:0008305 [integrin complex] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.