# [ GGRNA.v2 | 2024-05-03 02:10:39 ] # # seq:TCTCCACAAACGTTTTTAAAATGTG 4 # [INTERSECTION] 4 # # accession version gi length symbol synonym geneid division source definition nt_position aa_position NM_032753 NM_032753.4 2162 RAX2 ARMD6; CORD11; QRX; RAXL1; RP95 84839 RefSeq Homo sapiens (human) Homo sapiens retina and anterior neural fold homeobox 2 (RAX2), transcript variant 2, mRNA. 1962 NM_001319074 NM_001319074.4 2421 RAX2 ARMD6; CORD11; QRX; RAXL1; RP95 84839 RefSeq Homo sapiens (human) Homo sapiens retina and anterior neural fold homeobox 2 (RAX2), transcript variant 1, mRNA. 2221 XM_009434361 XM_009434361.4 2952 RAX2 RAXL1 468668 RefSeq Pan troglodytes (chimpanzee) PREDICTED: Pan troglodytes retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 2604 XM_055103724 XM_055103724.1 6110 RAX2 100975671 RefSeq Pan paniscus (pygmy chimpanzee) PREDICTED: Pan paniscus retina and anterior neural fold homeobox 2 (RAX2), mRNA. 4531