# [ GGRNA.v2 | 2024-04-28 06:18:27 ]
#
# seq:GGGACACGGCAGTAAGCACAAGAAA	21
# [INTERSECTION]	21
#
# accession	version	gi	length	symbol	synonym	geneid	division	source	definition	nt_position	aa_position
XM_050770740	XM_050770740.1		2129	RAX2		126942768	RefSeq	Macaca thibetana thibetana	PREDICTED: Macaca thibetana thibetana retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA.	1784	
NM_032753	NM_032753.4		2162	RAX2	ARMD6; CORD11; QRX; RAXL1; RP95	84839	RefSeq	Homo sapiens (human)	Homo sapiens retina and anterior neural fold homeobox 2 (RAX2), transcript variant 2, mRNA.	1814	
XM_007994799	XM_007994799.2		2392	RAX2		103233693	RefSeq	Chlorocebus sabaeus (Cercopithecus sabaeus)	PREDICTED: Chlorocebus sabaeus retina and anterior neural fold homeobox 2 (RAX2), mRNA.	2042	
XM_011967344	XM_011967344.1		2114	RAX2		105530022	RefSeq	Mandrillus leucophaeus (drill)	PREDICTED: Mandrillus leucophaeus retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA.	1769	
XM_050770739	XM_050770739.1		2384	RAX2		126942768	RefSeq	Macaca thibetana thibetana	PREDICTED: Macaca thibetana thibetana retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA.	2039	
NM_001319074	NM_001319074.4		2421	RAX2	ARMD6; CORD11; QRX; RAXL1; RP95	84839	RefSeq	Homo sapiens (human)	Homo sapiens retina and anterior neural fold homeobox 2 (RAX2), transcript variant 1, mRNA.	2073	
XM_011967343	XM_011967343.1		2369	RAX2		105530022	RefSeq	Mandrillus leucophaeus (drill)	PREDICTED: Mandrillus leucophaeus retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA.	2024	
XM_017847250	XM_017847250.1		2121	RAX2		108512134	RefSeq	Rhinopithecus bieti (black snub-nosed monkey)	PREDICTED: Rhinopithecus bieti retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA.	1772	
XM_001100945	XM_001100945.4		2114	RAX2		713929	RefSeq	Macaca mulatta (Rhesus monkey)	PREDICTED: Macaca mulatta retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA.	1770	
XM_009193161	XM_009193161.2		2123	RAX2		100998831	RefSeq	Papio anubis (olive baboon)	PREDICTED: Papio anubis retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA.	1778	
XM_033200187	XM_033200187.1		2126	RAX2		117076548	RefSeq	Trachypithecus francoisi (Francois's langur)	PREDICTED: Trachypithecus francoisi retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA.	1777	
XM_010367273	XM_010367273.2		2132	RAX2		104665435	RefSeq	Rhinopithecus roxellana (golden snub-nosed monkey)	PREDICTED: Rhinopithecus roxellana retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA.	1783	
XM_017847249	XM_017847249.1		2377	RAX2		108512134	RefSeq	Rhinopithecus bieti (black snub-nosed monkey)	PREDICTED: Rhinopithecus bieti retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA.	2028	
XM_002801027	XM_002801027.3		2371	RAX2		713929	RefSeq	Macaca mulatta (Rhesus monkey)	PREDICTED: Macaca mulatta retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA.	2027	
XM_033200186	XM_033200186.1		2381	RAX2		117076548	RefSeq	Trachypithecus francoisi (Francois's langur)	PREDICTED: Trachypithecus francoisi retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA.	2032	
XM_010367272	XM_010367272.2		2382	RAX2		104665435	RefSeq	Rhinopithecus roxellana (golden snub-nosed monkey)	PREDICTED: Rhinopithecus roxellana retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA.	2033	
XM_011747817	XM_011747817.2		2663	RAX2		105485450	RefSeq	Macaca nemestrina (pig-tailed macaque)	PREDICTED: Macaca nemestrina retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA.	2319	
XM_003914667	XM_003914667.2		2432	RAX2		100998831	RefSeq	Papio anubis (olive baboon)	PREDICTED: Papio anubis retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA.	2033	
XM_011747810	XM_011747810.2		2918	RAX2		105485450	RefSeq	Macaca nemestrina (pig-tailed macaque)	PREDICTED: Macaca nemestrina retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA.	2574	
XM_005587531	XM_005587531.2		3426	RAX2		102136169	RefSeq	Macaca fascicularis (crab-eating macaque)	PREDICTED: Macaca fascicularis retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA.	1808	
XM_015440231	XM_015440231.2		3711	RAX2		102136169	RefSeq	Macaca fascicularis (crab-eating macaque)	PREDICTED: Macaca fascicularis retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA.	2093