# [ GGRNA.v2 | 2024-05-03 21:26:53 ]
#
# seq:AGAAGTGCGGCACCAGGGCAGGAGC	26
# [INTERSECTION]	26
#
# accession	version	gi	length	symbol	synonym	geneid	division	source	definition	nt_position	aa_position
XM_055371299	XM_055371299.1		2085	RAX2		129528844	RefSeq	Gorilla gorilla gorilla (western lowland gorilla)	PREDICTED: Gorilla gorilla gorilla retina and anterior neural fold homeobox 2 (RAX2), mRNA.	1564	
XM_007994799	XM_007994799.2		2392	RAX2		103233693	RefSeq	Chlorocebus sabaeus (Cercopithecus sabaeus)	PREDICTED: Chlorocebus sabaeus retina and anterior neural fold homeobox 2 (RAX2), mRNA.	1880	
XM_050770740	XM_050770740.1		2129	RAX2		126942768	RefSeq	Macaca thibetana thibetana	PREDICTED: Macaca thibetana thibetana retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA.	1618	
NM_032753	NM_032753.4		2162	RAX2	ARMD6; CORD11; QRX; RAXL1; RP95	84839	RefSeq	Homo sapiens (human)	Homo sapiens retina and anterior neural fold homeobox 2 (RAX2), transcript variant 2, mRNA.	1641	
XM_011967344	XM_011967344.1		2114	RAX2		105530022	RefSeq	Mandrillus leucophaeus (drill)	PREDICTED: Mandrillus leucophaeus retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA.	1606	
XM_011943449	XM_011943449.1		2124	RAX2		105512828	RefSeq	Colobus angolensis palliatus	PREDICTED: Colobus angolensis palliatus retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA.	1609	
XM_017847250	XM_017847250.1		2121	RAX2		108512134	RefSeq	Rhinopithecus bieti (black snub-nosed monkey)	PREDICTED: Rhinopithecus bieti retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA.	1606	
XM_050770739	XM_050770739.1		2384	RAX2		126942768	RefSeq	Macaca thibetana thibetana	PREDICTED: Macaca thibetana thibetana retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA.	1873	
NM_001319074	NM_001319074.4		2421	RAX2	ARMD6; CORD11; QRX; RAXL1; RP95	84839	RefSeq	Homo sapiens (human)	Homo sapiens retina and anterior neural fold homeobox 2 (RAX2), transcript variant 1, mRNA.	1900	
XM_001100945	XM_001100945.4		2114	RAX2		713929	RefSeq	Macaca mulatta (Rhesus monkey)	PREDICTED: Macaca mulatta retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA.	1604	
XM_009193161	XM_009193161.2		2123	RAX2		100998831	RefSeq	Papio anubis (olive baboon)	PREDICTED: Papio anubis retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA.	1612	
XM_023200859	XM_023200859.3		2137	RAX2		111534229	RefSeq	Piliocolobus tephrosceles (Ugandan red Colobus)	PREDICTED: Piliocolobus tephrosceles retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA.	1622	
XM_025368382	XM_025368382.1		2115	RAX2		112613131	RefSeq	Theropithecus gelada (gelada)	PREDICTED: Theropithecus gelada retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA.	1605	
XM_011967343	XM_011967343.1		2369	RAX2		105530022	RefSeq	Mandrillus leucophaeus (drill)	PREDICTED: Mandrillus leucophaeus retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA.	1861	
XM_011943448	XM_011943448.1		2381	RAX2		105512828	RefSeq	Colobus angolensis palliatus	PREDICTED: Colobus angolensis palliatus retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA.	1866	
XM_017847249	XM_017847249.1		2377	RAX2		108512134	RefSeq	Rhinopithecus bieti (black snub-nosed monkey)	PREDICTED: Rhinopithecus bieti retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA.	1862	
XM_002801027	XM_002801027.3		2371	RAX2		713929	RefSeq	Macaca mulatta (Rhesus monkey)	PREDICTED: Macaca mulatta retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA.	1861	
XM_023200858	XM_023200858.3		2392	RAX2		111534229	RefSeq	Piliocolobus tephrosceles (Ugandan red Colobus)	PREDICTED: Piliocolobus tephrosceles retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA.	1877	
XM_003914667	XM_003914667.2		2432	RAX2		100998831	RefSeq	Papio anubis (olive baboon)	PREDICTED: Papio anubis retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA.	1867	
XM_025368381	XM_025368381.1		2372	RAX2		112613131	RefSeq	Theropithecus gelada (gelada)	PREDICTED: Theropithecus gelada retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA.	1862	
XM_009434361	XM_009434361.4		2952	RAX2	RAXL1	468668	RefSeq	Pan troglodytes (chimpanzee)	PREDICTED: Pan troglodytes retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA.	2283	
XM_011747817	XM_011747817.2		2663	RAX2		105485450	RefSeq	Macaca nemestrina (pig-tailed macaque)	PREDICTED: Macaca nemestrina retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA.	2153	
XM_005587531	XM_005587531.2		3426	RAX2		102136169	RefSeq	Macaca fascicularis (crab-eating macaque)	PREDICTED: Macaca fascicularis retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA.	1642	
XM_011747810	XM_011747810.2		2918	RAX2		105485450	RefSeq	Macaca nemestrina (pig-tailed macaque)	PREDICTED: Macaca nemestrina retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA.	2408	
XM_015440231	XM_015440231.2		3711	RAX2		102136169	RefSeq	Macaca fascicularis (crab-eating macaque)	PREDICTED: Macaca fascicularis retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA.	1927	
XM_055103724	XM_055103724.1		6110	RAX2		100975671	RefSeq	Pan paniscus (pygmy chimpanzee)	PREDICTED: Pan paniscus retina and anterior neural fold homeobox 2 (RAX2), mRNA.	4210