# [ GGRNA.v2 | 2024-05-02 16:02:23 ] # # seq:ACGGCAGTAAGCACAAGAAAGATTT 22 # [INTERSECTION] 22 # # accession version gi length symbol synonym geneid division source definition nt_position aa_position XM_050770740 XM_050770740.1 2129 RAX2 126942768 RefSeq Macaca thibetana thibetana PREDICTED: Macaca thibetana thibetana retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1789 NM_032753 NM_032753.4 2162 RAX2 ARMD6; CORD11; QRX; RAXL1; RP95 84839 RefSeq Homo sapiens (human) Homo sapiens retina and anterior neural fold homeobox 2 (RAX2), transcript variant 2, mRNA. 1819 XM_011967344 XM_011967344.1 2114 RAX2 105530022 RefSeq Mandrillus leucophaeus (drill) PREDICTED: Mandrillus leucophaeus retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1774 XM_050770739 XM_050770739.1 2384 RAX2 126942768 RefSeq Macaca thibetana thibetana PREDICTED: Macaca thibetana thibetana retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 2044 NM_001319074 NM_001319074.4 2421 RAX2 ARMD6; CORD11; QRX; RAXL1; RP95 84839 RefSeq Homo sapiens (human) Homo sapiens retina and anterior neural fold homeobox 2 (RAX2), transcript variant 1, mRNA. 2078 XM_011967343 XM_011967343.1 2369 RAX2 105530022 RefSeq Mandrillus leucophaeus (drill) PREDICTED: Mandrillus leucophaeus retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 2029 XM_017847250 XM_017847250.1 2121 RAX2 108512134 RefSeq Rhinopithecus bieti (black snub-nosed monkey) PREDICTED: Rhinopithecus bieti retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1777 XM_017847249 XM_017847249.1 2377 RAX2 108512134 RefSeq Rhinopithecus bieti (black snub-nosed monkey) PREDICTED: Rhinopithecus bieti retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 2033 XM_001100945 XM_001100945.4 2114 RAX2 713929 RefSeq Macaca mulatta (Rhesus monkey) PREDICTED: Macaca mulatta retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1775 XM_009193161 XM_009193161.2 2123 RAX2 100998831 RefSeq Papio anubis (olive baboon) PREDICTED: Papio anubis retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1783 XM_033200187 XM_033200187.1 2126 RAX2 117076548 RefSeq Trachypithecus francoisi (Francois's langur) PREDICTED: Trachypithecus francoisi retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1782 XM_010367273 XM_010367273.2 2132 RAX2 104665435 RefSeq Rhinopithecus roxellana (golden snub-nosed monkey) PREDICTED: Rhinopithecus roxellana retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1788 XM_023200859 XM_023200859.3 2137 RAX2 111534229 RefSeq Piliocolobus tephrosceles (Ugandan red Colobus) PREDICTED: Piliocolobus tephrosceles retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1793 XM_011747817 XM_011747817.2 2663 RAX2 105485450 RefSeq Macaca nemestrina (pig-tailed macaque) PREDICTED: Macaca nemestrina retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 2324 XM_002801027 XM_002801027.3 2371 RAX2 713929 RefSeq Macaca mulatta (Rhesus monkey) PREDICTED: Macaca mulatta retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 2032 XM_033200186 XM_033200186.1 2381 RAX2 117076548 RefSeq Trachypithecus francoisi (Francois's langur) PREDICTED: Trachypithecus francoisi retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 2037 XM_010367272 XM_010367272.2 2382 RAX2 104665435 RefSeq Rhinopithecus roxellana (golden snub-nosed monkey) PREDICTED: Rhinopithecus roxellana retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 2038 XM_023200858 XM_023200858.3 2392 RAX2 111534229 RefSeq Piliocolobus tephrosceles (Ugandan red Colobus) PREDICTED: Piliocolobus tephrosceles retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 2048 XM_003914667 XM_003914667.2 2432 RAX2 100998831 RefSeq Papio anubis (olive baboon) PREDICTED: Papio anubis retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 2038 XM_011747810 XM_011747810.2 2918 RAX2 105485450 RefSeq Macaca nemestrina (pig-tailed macaque) PREDICTED: Macaca nemestrina retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 2579 XM_005587531 XM_005587531.2 3426 RAX2 102136169 RefSeq Macaca fascicularis (crab-eating macaque) PREDICTED: Macaca fascicularis retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1813 XM_015440231 XM_015440231.2 3711 RAX2 102136169 RefSeq Macaca fascicularis (crab-eating macaque) PREDICTED: Macaca fascicularis retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 2098