# [ GGRNA.v2 | 2024-05-07 13:52:28 ] # # seq:AAAATGTGCCGGGTGTACTGGTGCA 2 # [INTERSECTION] 2 # # accession version gi length symbol synonym geneid division source definition nt_position aa_position NM_032753 NM_032753.4 2162 RAX2 ARMD6; CORD11; QRX; RAXL1; RP95 84839 RefSeq Homo sapiens (human) Homo sapiens retina and anterior neural fold homeobox 2 (RAX2), transcript variant 2, mRNA. 1979 NM_001319074 NM_001319074.4 2421 RAX2 ARMD6; CORD11; QRX; RAXL1; RP95 84839 RefSeq Homo sapiens (human) Homo sapiens retina and anterior neural fold homeobox 2 (RAX2), transcript variant 1, mRNA. 2238