LOCUS       NM_001183691            1383 bp    mRNA    linear   PLN 17-DEC-2024
DEFINITION  Saccharomyces cerevisiae S288C Ytm1p (YTM1), partial mRNA.
ACCESSION   NM_001183691
VERSION     NM_001183691.3
DBLINK      BioProject: PRJNA128
KEYWORDS    RefSeq.
SOURCE      Saccharomyces cerevisiae S288C
  ORGANISM  Saccharomyces cerevisiae S288C
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Saccharomycetes; Saccharomycetales; Saccharomycetaceae;
            Saccharomyces.
REFERENCE   1  (bases 1 to 1383)
  AUTHORS   Engel,S.R., Wong,E.D., Nash,R.S., Aleksander,S., Alexander,M.,
            Douglass,E., Karra,K., Miyasato,S.R., Simison,M., Skrzypek,M.S.,
            Weng,S. and Cherry,J.M.
  TITLE     New data and collaborations at the Saccharomyces Genome Database:
            updated reference genome, alleles, and the Alliance of Genome
            Resources
  JOURNAL   Genetics 220 (4) (2022)
   PUBMED   34897464
REFERENCE   2  (bases 1 to 1383)
  AUTHORS   Dujon,B., Albermann,K., Aldea,M., Alexandraki,D., Ansorge,W.,
            Arino,J., Benes,V., Bohn,C., Bolotin-Fukuhara,M., Bordonne,R.,
            Boyer,J., Camasses,A., Casamayor,A., Casas,C., Cheret,G.,
            Cziepluch,C., Daignan-Fornier,B., Dang,D.V., de Haan,M., Delius,H.,
            Durand,P., Fairhead,C., Feldmann,H., Gaillon,L., Kleine,K. et al.
  TITLE     The nucleotide sequence of Saccharomyces cerevisiae chromosome XV
  JOURNAL   Nature 387 (6632 SUPPL), 98-102 (1997)
   PUBMED   9169874
REFERENCE   3  (bases 1 to 1383)
  AUTHORS   Goffeau,A., Barrell,B.G., Bussey,H., Davis,R.W., Dujon,B.,
            Feldmann,H., Galibert,F., Hoheisel,J.D., Jacq,C., Johnston,M.,
            Louis,E.J., Mewes,H.W., Murakami,Y., Philippsen,P., Tettelin,H. and
            Oliver,S.G.
  TITLE     Life with 6000 genes
  JOURNAL   Science 274 (5287), 546 (1996)
   PUBMED   8849441
REFERENCE   4  (bases 1 to 1383)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (17-DEC-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   5  (bases 1 to 1383)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (16-JAN-2015) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Protein update by submitter
REFERENCE   6  (bases 1 to 1383)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (04-MAY-2012) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Protein update by submitter
REFERENCE   7  (bases 1 to 1383)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (31-MAR-2011) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Sequence update by submitter
REFERENCE   8  (bases 1 to 1383)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (27-MAY-2010) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Protein update by submitter
REFERENCE   9  (bases 1 to 1383)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (14-DEC-2009) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by SGD. This record
            is derived from an annotated genomic sequence (NC_001147).
            
            On Jul 30, 2012 this sequence version replaced NM_001183691.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider :: SGD
            Annotation Status   :: Full Annotation
            Annotation Version  :: R64-4-1
            URL                 :: http://www.yeastgenome.org/
            ##Genome-Annotation-Data-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..1383
                     /organism="Saccharomyces cerevisiae S288C"
                     /mol_type="mRNA"
                     /strain="S288C"
                     /db_xref="taxon:559292"
                     /chromosome="XV"
     gene            <1..>1383
                     /gene="YTM1"
                     /locus_tag="YOR272W"
                     /gene_synonym="CST14"
                     /db_xref="GeneID:854446"
     CDS             1..1383
                     /gene="YTM1"
                     /locus_tag="YOR272W"
                     /gene_synonym="CST14"
                     /experiment="EXISTENCE:direct assay:GO:0005634 nucleus
                     [PMID:11914276]"
                     /experiment="EXISTENCE:direct assay:GO:0005730 nucleolus
                     [PMID:11583614]"
                     /experiment="EXISTENCE:direct assay:GO:0030687
                     preribosome, large subunit precursor
                     [PMID:11583614|PMID:17443350]"
                     /experiment="EXISTENCE:direct assay:GO:0070545 PeBoW
                     complex [PMID:16287855]"
                     /experiment="EXISTENCE:direct assay:GO:0110136 protein-RNA
                     complex remodeling [PMID:20542003]"
                     /experiment="EXISTENCE:mutant phenotype:GO:0042273
                     ribosomal large subunit biogenesis [PMID:11583614]"
                     /experiment="EXISTENCE:mutant phenotype:GO:0051276
                     chromosome organization [PMID:10454593]"
                     /experiment="EXISTENCE:physical interaction:GO:0070545
                     PeBoW complex [PMID:16287855]"
                     /note="Ribosomal assembly factor and 66S pre-ribosomal
                     particle constituent; subunit of the Nop7-subcomplex
                     (PeBoW complex), required for an early nucleolar step in
                     pre-60S ribosomal particle maturation; interaction of its
                     ubiquitin-like (UBL) domain with the MIDAS domain in the
                     Rea1p tail triggers release of the subcomplex and possibly
                     other biogenesis factors via cycles of ATP hydrolysis;
                     involved in the processing of 27S pre-rRNA; contains an
                     N-terminal UBL domain and seven C-terminal WD repeats"
                     /codon_start=1
                     /product="Ytm1p"
                     /protein_id="NP_014915.3"
                     /db_xref="GeneID:854446"
                     /db_xref="SGD:S000005798"
                     /translation="

MTEDKSQVKIRFFTREKDELLHVQDTPMYAPISLKRYGLSEIVNHLLGSEKPVPFDFLIEGELLRTSLHDYLTKKGLSSEASLNVEYTRAILPPSYLNSFSNEDWVSSLDVGDGSKHIISGSYDGIVRTWDLSGNVQKQYSGHSGPIRAVKYISNTRLVSAGNDRTLRLWKTKNDDLKLTSQQQAQEDDDDEVNIEDGKTLAILEGHKAPVVSIDVSDNSRILSASYDNSIGFWSTIYKEMTVVDPLEDINNPNNKISTAARKRRKLTMKDGTIRRRAPLSLLESHTAPVEQVIFDSTDNTVGYSVSQDHTIKTWDLVTARCIDTRTTSYSLLSIAQLSTLNLLACGSSARHITLHDPRVGASSKVTQQQLIGHKNFVSSLDTCPENEYILCSGSHDGTVKVWDVRSTSPMYTITREDKSVQKGVNDKVFAVKWAEKVGIISAGQDKKIQINKGDNIFKN"

     misc_feature    22..216
                     /gene="YTM1"
                     /locus_tag="YOR272W"
                     /gene_synonym="CST14"
                     /note="NLE (NUC135) domain; Region: NLE; pfam08154"
                     /db_xref="CDD:462380"
     misc_feature    307..1353
                     /gene="YTM1"
                     /locus_tag="YOR272W"
                     /gene_synonym="CST14"
                     /note="WD40 domain, found in a number of eukaryotic
                     proteins that cover a wide variety of functions including
                     adaptor/regulatory modules in signal transduction,
                     pre-mRNA processing and cytoskeleton assembly; typically
                     contains a GH dipeptide 11-24 residues from...; Region:
                     WD40; cd00200"
                     /db_xref="CDD:238121"
     misc_feature    316..426
                     /gene="YTM1"
                     /locus_tag="YOR272W"
                     /gene_synonym="CST14"
                     /note="WD40 repeat [structural motif]; Region: WD40
                     repeat"
                     /db_xref="CDD:293791"
     misc_feature    order(358..360,370..372,388..393,424..429,478..480,
                     490..492,508..510,580..582,616..621,682..684,700..702,
                     745..747,856..858,910..912,925..927,943..948,982..987,
                     1036..1038,1048..1050,1066..1071,1117..1122,1174..1176,
                     1189..1191,1207..1212,1270..1275,1324..1326,1336..1338)
                     /gene="YTM1"
                     /locus_tag="YOR272W"
                     /gene_synonym="CST14"
                     /note="structural tetrad [active]"
                     /db_xref="CDD:238121"
     misc_feature    442..618
                     /gene="YTM1"
                     /locus_tag="YOR272W"
                     /gene_synonym="CST14"
                     /note="WD40 repeat [structural motif]; Region: WD40
                     repeat"
                     /db_xref="CDD:293791"
     misc_feature    724..852
                     /gene="YTM1"
                     /locus_tag="YOR272W"
                     /gene_synonym="CST14"
                     /note="WD40 repeat [structural motif]; Region: WD40
                     repeat"
                     /db_xref="CDD:293791"
     misc_feature    868..978
                     /gene="YTM1"
                     /locus_tag="YOR272W"
                     /gene_synonym="CST14"
                     /note="WD40 repeat [structural motif]; Region: WD40
                     repeat"
                     /db_xref="CDD:293791"
     misc_feature    994..1116
                     /gene="YTM1"
                     /locus_tag="YOR272W"
                     /gene_synonym="CST14"
                     /note="WD40 repeat [structural motif]; Region: WD40
                     repeat"
                     /db_xref="CDD:293791"
     misc_feature    1132..1209
                     /gene="YTM1"
                     /locus_tag="YOR272W"
                     /gene_synonym="CST14"
                     /note="WD40 repeat [structural motif]; Region: WD40
                     repeat"
                     /db_xref="CDD:293791"
ORIGIN      

atgacagaagataaatcgcaggttaaaatcaggtttttcacgcgtgagaaagatgaattactacatgtacaagatactccaatgtacgcccccatctcattaaagagatatgggttgtccgaaattgtcaatcacttgttgggctcggaaaagcctgttcctttcgatttcttgattgaaggtgaattgttacgtacttcattgcacgactatttgaccaagaaaggtttatcgagcgaagcctcgctgaatgtagaatataccagggcaattcttccaccatcctatttgaatagtttcagcaatgaggactgggttagctcattggatgtcggcgacggttccaagcatattattagtggttcttacgatggtatagttcgcacctgggatttatcaggtaatgtgcaaaagcagtacagtggtcattctggcccaatccgtgcagtaaaatacatttccaatacaaggctagtttcggctggtaacgaccgtactttgagattatggaaaaccaaaaacgatgatttgaaattaacttcacaacaacaggcacaggaagacgatgatgacgaagtaaacatagaggacggtaagacactggctatcttggaaggtcataaggcaccagtagtctctattgatgtttcagacaactcaagaatattatctgcatcatacgacaattctattgggttctggtctactatttataaggaaatgacagttgttgatccattagaagatataaacaatccaaacaataaaatatccactgctgctagaaaaaggagaaaattgacaatgaaagatggtaccattagaagacgtgcccctctgtctctgttagaatcccatacagctcctgttgagcaagtgatcttcgattctacagataataccgttggttattcagtatcacaagatcataccatcaagacatgggatttggtcaccgcgagatgtatagatacaagaacaacatcgtactcgttgctttccattgctcaattgtcgactttgaacttgttagcatgtgggtccagcgccagacacatcacattgcatgacccacgtgtgggagcgtcttccaaagttactcagcaacaactaattggtcataagaacttcgtttcctctctggacacttgtcccgagaatgagtatatattatgctcgggttctcacgatggtaccgtgaaggtatgggacgtcaggtctacttctccgatgtacaccataacaagagaagacaaatcggtccaaaagggcgtcaatgacaaagtttttgctgtcaaatgggctgaaaaagtgggtattatcagcgctggtcaagacaaaaagattcaaataaataaaggagacaacattttcaaaaactga

//