LOCUS       NM_001179982             588 bp    mRNA    linear   PLN 17-DEC-2024
DEFINITION  Saccharomyces cerevisiae S288C Igd1p (IGD1), partial mRNA.
ACCESSION   NM_001179982
VERSION     NM_001179982.1
DBLINK      BioProject: PRJNA128
KEYWORDS    RefSeq.
SOURCE      Saccharomyces cerevisiae S288C
  ORGANISM  Saccharomyces cerevisiae S288C
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Saccharomycetes; Saccharomycetales; Saccharomycetaceae;
            Saccharomyces.
REFERENCE   1  (bases 1 to 588)
  AUTHORS   Engel,S.R., Wong,E.D., Nash,R.S., Aleksander,S., Alexander,M.,
            Douglass,E., Karra,K., Miyasato,S.R., Simison,M., Skrzypek,M.S.,
            Weng,S. and Cherry,J.M.
  TITLE     New data and collaborations at the Saccharomyces Genome Database:
            updated reference genome, alleles, and the Alliance of Genome
            Resources
  JOURNAL   Genetics 220 (4) (2022)
   PUBMED   34897464
REFERENCE   2  (bases 1 to 588)
  AUTHORS   Goffeau,A., Barrell,B.G., Bussey,H., Davis,R.W., Dujon,B.,
            Feldmann,H., Galibert,F., Hoheisel,J.D., Jacq,C., Johnston,M.,
            Louis,E.J., Mewes,H.W., Murakami,Y., Philippsen,P., Tettelin,H. and
            Oliver,S.G.
  TITLE     Life with 6000 genes
  JOURNAL   Science 274 (5287), 546 (1996)
   PUBMED   8849441
REFERENCE   3  (bases 1 to 588)
  AUTHORS   Murakami,Y., Naitou,M., Hagiwara,H., Shibata,T., Ozawa,M.,
            Sasanuma,S., Sasanuma,M., Tsuchiya,Y., Soeda,E., Yokoyama,K. et al.
  TITLE     Analysis of the nucleotide sequence of chromosome VI from
            Saccharomyces cerevisiae
  JOURNAL   Nat. Genet. 10 (3), 261-268 (1995)
   PUBMED   7670463
REFERENCE   4  (bases 1 to 588)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (17-DEC-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   5  (bases 1 to 588)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (16-JAN-2015) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Protein update by submitter
REFERENCE   6  (bases 1 to 588)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (04-MAY-2012) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Protein update by submitter
REFERENCE   7  (bases 1 to 588)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (31-MAR-2011) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Sequence update by submitter
REFERENCE   8  (bases 1 to 588)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (11-DEC-2009) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by SGD. This record
            is derived from an annotated genomic sequence (NC_001138).
            
            ##Genome-Annotation-Data-START##
            Annotation Provider :: SGD
            Annotation Status   :: Full Annotation
            Annotation Version  :: R64-4-1
            URL                 :: http://www.yeastgenome.org/
            ##Genome-Annotation-Data-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..588
                     /organism="Saccharomyces cerevisiae S288C"
                     /mol_type="mRNA"
                     /strain="S288C"
                     /db_xref="taxon:559292"
                     /chromosome="VI"
     gene            <1..>588
                     /gene="IGD1"
                     /locus_tag="YFR017C"
                     /db_xref="GeneID:850572"
     CDS             1..588
                     /gene="IGD1"
                     /locus_tag="YFR017C"
                     /experiment="EXISTENCE:direct assay:GO:0004857 enzyme
                     inhibitor activity [PMID:21585652]"
                     /experiment="EXISTENCE:direct assay:GO:0005737 cytoplasm
                     [PMID:14562095]"
                     /experiment="EXISTENCE:mutant phenotype:GO:0004857 enzyme
                     inhibitor activity [PMID:21585652]"
                     /experiment="EXISTENCE:mutant phenotype:GO:0045818
                     negative regulation of glycogen catabolic process
                     [PMID:21585652]"
                     /note="Cytoplasmic protein that inhibits Gdb1p glycogen
                     debranching activity; required for normal intracellular
                     accumulation of glycogen; phosphorylated in vivo;
                     expression increases during wine fermentation; protein
                     abundance increases in response to DNA replication stress;
                     IGD1 has a paralog, YOL024W, that arose from the whole
                     genome duplication"
                     /codon_start=1
                     /product="Igd1p"
                     /protein_id="NP_116672.1"
                     /db_xref="GeneID:850572"
                     /db_xref="SGD:S000001913"
                     /translation="

MTDPHLNTPQVSTSPTFERSQDFLNIDEPPCAQETPSVSTFNLPGPSAPAQSVDKPVPMIRRRSTNYMDALNSREQARERESSIGEHAPGAERRSSGPMDFQNTIHNMQYRTTNDSDLSHAGVDMGDSISHTPICSRAGNRPIFKNSYLDNNSNGNSARVPHGSPPQLGTRRKSSFKYEDFKKDIYNQLHMFGEK"

ORIGIN      

atgacagatccccacttgaacacgccccaagtgagcacgtcacccacatttgaaagatcacaggacttcctcaacatcgacgaaccgccctgtgcacaggaaacacctagtgtttctacattcaacctcccgggtccaagcgctcccgctcaaagcgtagacaagccagtccccatgattagacggcggtctaccaattatatggacgcactaaattccagggaacaagcccgggaacgcgaaagcagtatcggggagcacgccccgggagccgaacgtaggagtagcggacccatggatttccagaatactatccacaatatgcaatacaggaccactaacgactctgacctgagccacgctggcgtggatatgggtgactccatctcccatacaccgatctgttctcgtgctggcaacagacccattttcaaaaactcgtaccttgacaacaacagcaatggtaacagcgcaagagtcccacacggctctcctccacagttgggcacgcgtagaaagtcgtcttttaagtacgaggactttaagaaggacatctataaccagcttcacatgtttggagagaagtaa

//