LOCUS       NM_001179921             624 bp    mRNA    linear   PLN 17-DEC-2024
DEFINITION  Saccharomyces cerevisiae S288C Fmp32p (FMP32), partial mRNA.
ACCESSION   NM_001179921
VERSION     NM_001179921.1
DBLINK      BioProject: PRJNA128
KEYWORDS    RefSeq.
SOURCE      Saccharomyces cerevisiae S288C
  ORGANISM  Saccharomyces cerevisiae S288C
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Saccharomycetes; Saccharomycetales; Saccharomycetaceae;
            Saccharomyces.
REFERENCE   1  (bases 1 to 624)
  AUTHORS   Engel,S.R., Wong,E.D., Nash,R.S., Aleksander,S., Alexander,M.,
            Douglass,E., Karra,K., Miyasato,S.R., Simison,M., Skrzypek,M.S.,
            Weng,S. and Cherry,J.M.
  TITLE     New data and collaborations at the Saccharomyces Genome Database:
            updated reference genome, alleles, and the Alliance of Genome
            Resources
  JOURNAL   Genetics 220 (4) (2022)
   PUBMED   34897464
REFERENCE   2  (bases 1 to 624)
  AUTHORS   Goffeau,A., Barrell,B.G., Bussey,H., Davis,R.W., Dujon,B.,
            Feldmann,H., Galibert,F., Hoheisel,J.D., Jacq,C., Johnston,M.,
            Louis,E.J., Mewes,H.W., Murakami,Y., Philippsen,P., Tettelin,H. and
            Oliver,S.G.
  TITLE     Life with 6000 genes
  JOURNAL   Science 274 (5287), 546 (1996)
   PUBMED   8849441
REFERENCE   3  (bases 1 to 624)
  AUTHORS   Murakami,Y., Naitou,M., Hagiwara,H., Shibata,T., Ozawa,M.,
            Sasanuma,S., Sasanuma,M., Tsuchiya,Y., Soeda,E., Yokoyama,K. et al.
  TITLE     Analysis of the nucleotide sequence of chromosome VI from
            Saccharomyces cerevisiae
  JOURNAL   Nat. Genet. 10 (3), 261-268 (1995)
   PUBMED   7670463
REFERENCE   4  (bases 1 to 624)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (17-DEC-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   5  (bases 1 to 624)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (16-JAN-2015) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Protein update by submitter
REFERENCE   6  (bases 1 to 624)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (04-MAY-2012) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Protein update by submitter
REFERENCE   7  (bases 1 to 624)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (31-MAR-2011) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Sequence update by submitter
REFERENCE   8  (bases 1 to 624)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (11-DEC-2009) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by SGD. This record
            is derived from an annotated genomic sequence (NC_001138).
            
            ##Genome-Annotation-Data-START##
            Annotation Provider :: SGD
            Annotation Status   :: Full Annotation
            Annotation Version  :: R64-4-1
            URL                 :: http://www.yeastgenome.org/
            ##Genome-Annotation-Data-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..624
                     /organism="Saccharomyces cerevisiae S288C"
                     /mol_type="mRNA"
                     /strain="S288C"
                     /db_xref="taxon:559292"
                     /chromosome="VI"
     gene            <1..>624
                     /gene="FMP32"
                     /locus_tag="YFL046W"
                     /gene_synonym="PUT6"
                     /db_xref="GeneID:850498"
     CDS             1..624
                     /gene="FMP32"
                     /locus_tag="YFL046W"
                     /gene_synonym="PUT6"
                     /experiment="EXISTENCE:direct assay:GO:0005739
                     mitochondrion
                     [PMID:16823961|PMID:26928762|PMID:24769239|PMID:14576278|P
                     MID:12514182]"
                     /experiment="EXISTENCE:direct assay:GO:0005743
                     mitochondrial inner membrane [PMID:32978391]"
                     /experiment="EXISTENCE:mutant phenotype:GO:0033617
                     mitochondrial cytochrome c oxidase assembly
                     [PMID:25565209]"
                     /experiment="EXISTENCE:mutant phenotype:GO:2000214
                     regulation of proline metabolic process [PMID:32978391]"
                     /note="Regulator of mitochondrial proline metabolism;
                     tethered with Put7p to inner mitochondrial membrane in
                     large hetero-oligomeric complex, abundance of which is
                     regulated by proline; involved in mitochondrial proline
                     homeostasis and cellular redox balance; null exhibits
                     pronounced defect in proline utilization, and can be
                     functionally complemented by expression of human homolog
                     MCUR1"
                     /codon_start=1
                     /product="Fmp32p"
                     /protein_id="NP_116608.1"
                     /db_xref="GeneID:850498"
                     /db_xref="SGD:S000001848"
                     /translation="

MLKRIVGLPARRCFHRTSFLLGSDFETVHIPNTNHFKDLLIENGKFQEDQATTIVEIMTDAIRGGVNHVSQDLAKREKLTQLSYQQRVDFAKLRDQLLSADRSEFHNIQNEYESVKNDLEKLRNKLREEITKTNAGFKLDLSLEKGRIREESSHHDLQIKEIDTKIEQEVTNMKMQIDSVKTQVMQWLIGVCTGTFALVLAYMRLLT"

     misc_feature    94..618
                     /gene="FMP32"
                     /locus_tag="YFL046W"
                     /gene_synonym="PUT6"
                     /note="Coiled-coil domain-containing protein 90-like;
                     Region: CCDC90-like; pfam07798"
                     /db_xref="CDD:462268"
ORIGIN      

atgctcaagcgtattgttggattgcctgcaaggcgttgctttcatagaacgtcctttttgctgggcagtgactttgaaactgtgcatattcccaatacgaaccactttaaagatttacttatagagaacggtaaatttcaagaggatcaagcaactacaatagtagagataatgacagatgcaattaggggcggggttaatcatgtttcacaggatctggcaaagagagaaaaattgacccaacttagctatcaacaacgtgttgattttgcaaagttaagagatcagctattgagtgctgatagaagtgaatttcacaatattcaaaacgagtacgaaagtgtgaaaaacgatctggagaaactaagaaacaaactaagggaagaaattaccaaaacaaacgccggtttcaaacttgatctgtccttagaaaaaggcagaattagggaagaaagtagtcatcacgatctgcaaataaaagaaatcgacaccaaaattgagcaagaagtgaccaatatgaagatgcagattgattctgtcaagactcaagtcatgcaatggctgataggtgtctgtacaggtacatttgcacttgtattagcatatatgaggttattaacatag

//