LOCUS       NM_001179346            1404 bp    mRNA    linear   PLN 17-DEC-2024
DEFINITION  Saccharomyces cerevisiae S288C acid phosphatase PHO12 (PHO12),
            partial mRNA.
ACCESSION   NM_001179346
VERSION     NM_001179346.1
DBLINK      BioProject: PRJNA128
KEYWORDS    RefSeq.
SOURCE      Saccharomyces cerevisiae S288C
  ORGANISM  Saccharomyces cerevisiae S288C
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
            Saccharomycetes; Saccharomycetales; Saccharomycetaceae;
            Saccharomyces.
REFERENCE   1  (bases 1 to 1404)
  AUTHORS   Engel,S.R., Wong,E.D., Nash,R.S., Aleksander,S., Alexander,M.,
            Douglass,E., Karra,K., Miyasato,S.R., Simison,M., Skrzypek,M.S.,
            Weng,S. and Cherry,J.M.
  TITLE     New data and collaborations at the Saccharomyces Genome Database:
            updated reference genome, alleles, and the Alliance of Genome
            Resources
  JOURNAL   Genetics 220 (4) (2022)
   PUBMED   34897464
REFERENCE   2  (bases 1 to 1404)
  AUTHORS   Goffeau,A., Barrell,B.G., Bussey,H., Davis,R.W., Dujon,B.,
            Feldmann,H., Galibert,F., Hoheisel,J.D., Jacq,C., Johnston,M.,
            Louis,E.J., Mewes,H.W., Murakami,Y., Philippsen,P., Tettelin,H. and
            Oliver,S.G.
  TITLE     Life with 6000 genes
  JOURNAL   Science 274 (5287), 546 (1996)
   PUBMED   8849441
REFERENCE   3  (bases 1 to 1404)
  AUTHORS   Johnston,M., Andrews,S., Brinkman,R., Cooper,J., Ding,H., Dover,J.,
            Du,Z., Favello,A., Fulton,L., Gattung,S. et al.
  TITLE     Complete nucleotide sequence of Saccharomyces cerevisiae chromosome
            VIII
  JOURNAL   Science 265 (5181), 2077-2082 (1994)
   PUBMED   8091229
REFERENCE   4  (bases 1 to 1404)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (17-DEC-2024) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   5  (bases 1 to 1404)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (04-MAY-2012) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Protein update by submitter
REFERENCE   6  (bases 1 to 1404)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (31-MAR-2011) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
  REMARK    Sequence update by submitter
REFERENCE   7  (bases 1 to 1404)
  CONSRTM   Saccharomyces Genome Database
  TITLE     Direct Submission
  JOURNAL   Submitted (11-DEC-2009) Department of Genetics, Stanford
            University, Stanford, CA 94305-5120, USA
COMMENT     REVIEWED REFSEQ: This record has been curated by SGD. This record
            is derived from an annotated genomic sequence (NC_001140).
            
            ##Genome-Annotation-Data-START##
            Annotation Provider :: SGD
            Annotation Status   :: Full Annotation
            Annotation Version  :: R64-4-1
            URL                 :: http://www.yeastgenome.org/
            ##Genome-Annotation-Data-END##
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..1404
                     /organism="Saccharomyces cerevisiae S288C"
                     /mol_type="mRNA"
                     /strain="S288C"
                     /db_xref="taxon:559292"
                     /chromosome="VIII"
     gene            <1..>1404
                     /gene="PHO12"
                     /locus_tag="YHR215W"
                     /gene_synonym="PHO10"
                     /db_xref="GeneID:856625"
     CDS             1..1404
                     /gene="PHO12"
                     /locus_tag="YHR215W"
                     /gene_synonym="PHO10"
                     /EC_number="3.1.3.2"
                     /experiment="EXISTENCE:direct assay:GO:0000324 fungal-type
                     vacuole [PMID:14562095]"
                     /experiment="EXISTENCE:direct assay:GO:0003993 acid
                     phosphatase activity [PMID:8817921]"
                     /note="One of three repressible acid phosphatases;
                     glycoprotein that is transported to the cell surface by
                     the secretory pathway; pregulated by phosphate starvation;
                     PHO12 has a paralog, PHO11, that arose from a segmental
                     duplication"
                     /codon_start=1
                     /product="acid phosphatase PHO12"
                     /protein_id="NP_012087.1"
                     /db_xref="GeneID:856625"
                     /db_xref="SGD:S000001258"
                     /translation="

MLKSAVYSILAASLVNAGTIPLGKLSDIDKIGTQTEIFPFLGGSGPYYSFPGDYGISRDLPESCEMKQVQMVGRHGERYPTVSKAKSIMTTWYKLSNYTGQFSGALSFLNDDYEFFIRDTKNLEMETTLANSVNVLNPYTGEMNAKRHARDFLAQYGYMVENQTSFAVFTSNSNRCHDTAQYFIDGLGDKFNISLQTISEAESAGANTLSAHHSCPAWDDDVNDDILKKYDTKYLSGIAKRLNKENKGLNLTSSDANTFFAWCAYEINARGYSDICNIFTKDELVRFSYGQDLETYYQTGPGYDVVRSVGANLFNASVKLLKESEVQDQKVWLSFTHDTDILNYLTTIGIIDDQNNLTAEHVPFMENTFHRSWYVPQGARVYTEKFQCSNDTYVRYVINDAVVPIETCSTGPGFSCEINDFYGYAEKRVAGTDFLKVCNVSSVSNSTELTFFWDWNTKHYNDTLLKQ"

     misc_feature    193..1197
                     /gene="PHO12"
                     /locus_tag="YHR215W"
                     /gene_synonym="PHO10"
                     /note="Histidine phosphatase superfamily (branch 2);
                     Region: His_Phos_2; pfam00328"
                     /db_xref="CDD:395259"
     misc_feature    order(220..225,232..234,523..525,1009..1014)
                     /gene="PHO12"
                     /locus_tag="YHR215W"
                     /gene_synonym="PHO10"
                     /note="catalytic core [active]"
                     /db_xref="CDD:132717"
ORIGIN      

atgttgaagtcagccgtttattcaattttagccgcttctttggttaatgcaggtaccatacccctcggaaagttatctgacattgacaaaatcggaactcaaacggaaattttcccatttttgggtggttctgggccatactactctttccctggtgattatggtatttctcgtgatttgccggaaagttgtgaaatgaagcaagtgcaaatggttggtagacacggtgaaagataccccactgtcagcaaagccaaaagtatcatgacaacgtggtacaaattgagtaactataccggtcaattcagcggagcattgtctttcttgaacgatgactacgaatttttcattcgtgacaccaaaaacctagaaatggaaaccacacttgccaattcggtcaatgttttgaacccatataccggtgagatgaatgctaagagacacgctcgtgatttcttggcgcaatatggctacatggtcgaaaaccaaaccagttttgccgtttttacgtctaactcgaacagatgtcatgatactgcccagtatttcattgacggtttgggtgataaattcaacatatccttgcaaaccatcagtgaagccgagtctgctggtgccaatactctgagtgcccaccattcgtgtcctgcttgggacgatgatgtcaacgatgacattttgaaaaaatatgataccaaatatttgagtggtattgccaagagattaaacaaggaaaacaagggtttgaatctgacttcaagtgatgcaaacactttttttgcatggtgtgcatatgaaataaacgctagaggttacagtgacatctgtaacatcttcaccaaagatgaattggtccgtttctcctacggccaagacttggaaacttattatcaaacgggaccaggctatgacgtcgtcagatccgtcggtgccaacttgttcaacgcttcagtgaaactactaaaggaaagtgaggtccaggaccaaaaggtttggttgagtttcacccacgataccgatattctgaactatttgaccactatcggcataatcgatgaccaaaataacttgaccgccgaacatgttccattcatggaaaacactttccacagatcctggtacgttccacaaggtgctcgtgtttacactgaaaagttccagtgttccaatgacacctatgttagatacgtcatcaacgatgctgtcgttccaattgaaacctgttctactggtccagggttctcttgtgaaataaatgacttctacggctatgctgaaaagagagtagccggtactgacttcctaaaggtctgtaacgtcagcagcgtcagtaactctactgaattgacctttttctgggactggaataccaagcactacaacgacactttattaaaacagtaa

//