2024-11-01 07:58:11, GGRNA.v2 : RefSeq release 226 (Sep, 2024)
LOCUS NM_022512 1748 bp mRNA linear ROD 03-APR-2024 DEFINITION Rattus norvegicus acyl-CoA dehydrogenase short chain (Acads), mRNA; nuclear gene for mitochondrial product. ACCESSION NM_022512 VERSION NM_022512.2 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 1748) AUTHORS Zhong,X., Li,Z., Xu,Q., Peng,H., Su,Y., Le,K., Shu,Z., Liao,Y., Ma,Z., Pan,X., Xu,S. and Zhou,S. TITLE Short-chain acyl-CoA dehydrogenase is a potential target for the treatment of vascular remodelling JOURNAL J Hypertens 41 (5), 775-793 (2023) PUBMED 36883465 REMARK GeneRIF: Short-chain acyl-CoA dehydrogenase is a potential target for the treatment of vascular remodelling. REFERENCE 2 (bases 1 to 1748) AUTHORS Zeng,Z., Huang,Q., Shu,Z., Liu,P., Chen,S., Pan,X., Zang,L. and Zhou,S. TITLE Effects of short-chain acyl-CoA dehydrogenase on cardiomyocyte apoptosis JOURNAL J Cell Mol Med 20 (7), 1381-1391 (2016) PUBMED 26989860 REMARK GeneRIF: the role of SCAD in tert-butyl hydroperoxide (tBHP)-induced cardiomyocyte apoptosis, is reported. REFERENCE 3 (bases 1 to 1748) AUTHORS Huang,J., Xu,L., Huang,Q., Luo,J., Liu,P., Chen,S., Yuan,X., Lu,Y., Wang,P. and Zhou,S. TITLE Changes in short-chain acyl-coA dehydrogenase during rat cardiac development and stress JOURNAL J Cell Mol Med 19 (7), 1672-1688 (2015) PUBMED 25753319 REMARK GeneRIF: the down-regulated expression of SCAD in pathological cardiac hypertrophy may be responsible for 'the recapitulation of foetal energy metabolism'. REFERENCE 4 (bases 1 to 1748) AUTHORS Huang,Q., Huang,J., Zeng,Z., Luo,J., Liu,P., Chen,S., Liu,B., Pan,X., Zang,L. and Zhou,S. TITLE Effects of ERK1/2/PPARalpha/SCAD signal pathways on cardiomyocyte hypertrophy induced by insulin-like growth factor 1 and phenylephrine JOURNAL Life Sci 124, 41-49 (2015) PUBMED 25636810 REMARK GeneRIF: the phosphorylation of ERK1/2 inhibited the expression and activity of SCAD through the PPARalpha signaling pathway, which induced the development of pathological cardiomyocyte hypertrophy. REFERENCE 5 (bases 1 to 1748) AUTHORS de Mateo,S., Castillo,J., Estanyol,J.M., Ballesca,J.L. and Oliva,R. TITLE Proteomic characterization of the human sperm nucleus JOURNAL Proteomics 11 (13), 2714-2726 (2011) PUBMED 21630459 REFERENCE 6 (bases 1 to 1748) AUTHORS Matsubara,Y., Indo,Y., Naito,E., Ozasa,H., Glassberg,R., Vockley,J., Ikeda,Y., Kraus,J. and Tanaka,K. TITLE Molecular cloning and nucleotide sequence of cDNAs encoding the precursors of rat long chain acyl-coenzyme A, short chain acyl-coenzyme A, and isovaleryl-coenzyme A dehydrogenases. Sequence homology of four enzymes of the acyl-CoA dehydrogenase family JOURNAL J Biol Chem 264 (27), 16321-16331 (1989) PUBMED 2777793 REFERENCE 7 (bases 1 to 1748) AUTHORS Finocchiaro,G., Ito,M. and Tanaka,K. TITLE Purification and properties of short chain acyl-CoA, medium chain acyl-CoA, and isovaleryl-CoA dehydrogenases from human liver JOURNAL J Biol Chem 262 (17), 7982-7989 (1987) PUBMED 3597357 REFERENCE 8 (bases 1 to 1748) AUTHORS Ikeda,Y., Keese,S.M., Fenton,W.A. and Tanaka,K. TITLE Biosynthesis of four rat liver mitochondrial acyl-CoA dehydrogenases: in vitro synthesis, import into mitochondria, and processing of their precursors in a cell-free system and in cultured cells JOURNAL Arch Biochem Biophys 252 (2), 662-674 (1987) PUBMED 3813556 REFERENCE 9 (bases 1 to 1748) AUTHORS Coulson,A. TITLE Treatment of metritis in cattle with prostaglandin F2 alpha JOURNAL Vet Rec 103 (16), 359 (1978) PUBMED 734878 REFERENCE 10 (bases 1 to 1748) AUTHORS Dabrowski,Z., Gregorczyk,J., Samochowiec,L., Wojcicki,J., Lawczynski,L., Antoszczyk,M., Chrzanowska-Ansilewska,K., Jurek,D. and Sych,Z. TITLE [Effect of truncal vagotomy on the exocrine function of the pancreas in the dog] JOURNAL Pol Tyg Lek 33 (28), 1093-1095 (1978) PUBMED 704405 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from J05030.1. On Aug 31, 2012 this sequence version replaced NM_022512.1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: J05030.1, BC072545.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMD00132261, SAMD00132262 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## gene product(s) localized to mito. :: inferred from homology RefSeq Select criteria :: based on conservation, expression ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1748 J05030.1 2-1749 FEATURES Location/Qualifiers source 1..1748 /organism="Rattus norvegicus" /mol_type="mRNA" /db_xref="taxon:10116" /chromosome="12" /map="12q16" gene 1..1748 /gene="Acads" /gene_synonym="Scad" /note="acyl-CoA dehydrogenase short chain" /db_xref="GeneID:64304" /db_xref="RGD:620514" exon 1..78 /gene="Acads" /gene_synonym="Scad" /inference="alignment:Splign:2.1.0" CDS 27..1271 /gene="Acads" /gene_synonym="Scad" /EC_number="1.3.8.1" /note="short-chain specific acyl-CoA dehydrogenase, mitochondrial; butyryl-CoA dehydrogenase; short chain acyl-coenzyme A dehydrogenase; acetyl-Coenzyme A dehydrogenase, short chain; short-chain acyl-CoA dehydrogenase; acyl-Coenzyme A dehydrogenase, short chain; acyl-Coenzyme A dehydrogenase, C-2 to C-3 short chain; acyl-CoA dehydrogenase, C-2 to C-3 short chain" /codon_start=1 /product="short-chain specific acyl-CoA dehydrogenase, mitochondrial precursor" /protein_id="NP_071957.1" /db_xref="GeneID:64304" /db_xref="RGD:620514" /translation="
MAMAAALLARAGGSLGRALRARDWRRLHTVYQSVELPETHQMLRQTCRDFAEKELVPIAAQLDKEHLFPTSQVKKMGELGLLAMDVPEELSGAGLDYLAYSIALEEISRGCASTGVIMSVNNSLYLGPILKFGSSQQKQQWITPFTNGDKIGCFALSEPGNGSDAGAASTTAREEGDSWVLNGTKAWITNSWEASATVVFASTDRSRQNKGISAFLVPMPTPGLTLGKKEDKLGIRASSTANLIFEDCRIPKENLLGEPGMGFKIAMQTLDMGRIGIASQALGIAQASLDCAVKYAENRHAFGAPLTKLQNIQFKLADMALALESARLLTWRAAMLKDNKKPFTKESAMAKLAASEAATAISHQAIQILGGMGYVTEMPAERYYRDARITEIYEGTSEIQRLVIAGHLLRSYRS"
sig_peptide 27..104 /gene="Acads" /gene_synonym="Scad" /note="short chain acyl-CoA dehydrogenase signal peptide" mat_peptide 105..1268 /gene="Acads" /gene_synonym="Scad" /product="short-chain specific acyl-CoA dehydrogenase, mitochondrial" misc_feature 138..1256 /gene="Acads" /gene_synonym="Scad" /note="Short chain acyl-CoA dehydrogenases and eukaryotic short/branched chain acyl-CoA dehydrogenases; Region: SCAD_SBCAD; cd01158" /db_xref="CDD:173847" misc_feature order(486..488,495..497,513..515,585..587,591..593, 1125..1127,1137..1139,1206..1208) /gene="Acads" /gene_synonym="Scad" /note="FAD binding site [chemical binding]; other site" /db_xref="CDD:173847" misc_feature order(501..503,516..518,585..587,714..728,921..923, 930..932,957..959,969..974,978..980,987..989,1011..1013, 1080..1082,1113..1115,1125..1127,1140..1142,1146..1148, 1152..1157,1167..1169,1176..1181,1188..1193,1197..1199, 1218..1220,1227..1229,1236..1238) /gene="Acads" /gene_synonym="Scad" /note="homotetramer interface [polypeptide binding]; other site" /db_xref="CDD:173847" misc_feature order(513..518,825..827,834..839,846..848,930..932, 1206..1208) /gene="Acads" /gene_synonym="Scad" /note="substrate binding pocket [chemical binding]; other site" /db_xref="CDD:173847" misc_feature 1206..1208 /gene="Acads" /gene_synonym="Scad" /note="catalytic base [active]" /db_xref="CDD:173847" exon 79..242 /gene="Acads" /gene_synonym="Scad" /inference="alignment:Splign:2.1.0" exon 243..392 /gene="Acads" /gene_synonym="Scad" /inference="alignment:Splign:2.1.0" exon 393..504 /gene="Acads" /gene_synonym="Scad" /inference="alignment:Splign:2.1.0" exon 505..656 /gene="Acads" /gene_synonym="Scad" /inference="alignment:Splign:2.1.0" exon 657..827 /gene="Acads" /gene_synonym="Scad" /inference="alignment:Splign:2.1.0" exon 828..965 /gene="Acads" /gene_synonym="Scad" /inference="alignment:Splign:2.1.0" exon 966..1061 /gene="Acads" /gene_synonym="Scad" /inference="alignment:Splign:2.1.0" exon 1062..1118 /gene="Acads" /gene_synonym="Scad" /inference="alignment:Splign:2.1.0" exon 1119..1748 /gene="Acads" /gene_synonym="Scad" /inference="alignment:Splign:2.1.0" ORIGIN
tcaggaggtcccggaggtctgtgcccatggccatggccgctgcgttgctcgcccgggccggtggctctctcggcagagctctccgcgctcgagattggcgaagattacatactgtttaccagtctgtggaactacctgagacacatcagatgttgcgccagacatgccgggactttgctgagaaggagctggtccccatcgctgcccagctggacaaggaacatctcttccccacatcgcaggtgaagaagatgggggagctcgggctgctggccatggatgtgccagaggagctgagtggtgctggcctggattacctggcctactcgatcgccctggaggagatcagccgtggctgcgcctccaccggagtgatcatgagtgtcaacaactctctctacttgggacccatcctgaagttcggatcctcacagcagaagcagcagtggatcacccctttcaccaacggtgacaaaatcggctgttttgccctcagtgagccaggcaatggcagtgacgcgggggccgcttccaccactgcccgggaagagggtgactcctgggtcctcaacggcaccaaagcctggatcaccaactcctgggaggcttctgccacggtggtgtttgctagcaccgacaggtcccggcagaacaagggtatcagcgctttcctggttcccatgccaactcctgggcttacgctgggcaaaaaggaagacaagctgggcatccgggcctcatctacagctaacctcatctttgaggactgtcgcatccccaaggagaacctgctcggcgagcctgggatgggcttcaagatagccatgcaaaccctggacatgggccgcattggcatcgcctcccaggccctgggtattgcccaggcctccctggattgtgccgtgaagtacgccgagaaccgccatgcctttggggcacccctcacaaagctccaaaacatccagttcaagctggcagacatggccctggccctggagagtgcccgcctgctgacctggcgcgccgccatgttgaaggacaataagaagcctttcaccaaggagtcggccatggccaagctggctgcatcagaggctgctactgccattagccaccaggccatccagatcctgggcggcatggggtacgtgacagagatgccagccgagcgctactaccgagatgcccgcatcactgagatctatgaaggtaccagcgaaatccagagactggtgattgccgggcatctgctccggagctaccggagctgagcccccgcccttcttgggaacttgccagcctgctcagaccatgaagggacctgcctcggtcagcctttctgcccctcactgtagcccccagtcagactaggggaaagtctgtctcagggagagggaaggtcaaccgctgtgacctgtcagctcagaatggggcggcgtggctacctctttaccccccaccaacagtgcctctctctttgagcgacctgctggaggcagggccacagagacctgaatgaccctggccctcccaatgcggatgccgttcccaagagtcctcagaggcaagaacaggaggggcagggcggggtgaggaggggaaggggatggcccagtgcttgagtccccagggttgtcgtgggaaggctggggaaccggatcatagggccctggctagaggtcaagtggccgcaggtggttctgtggctgtagagctgcctgtggtcaataaagctcacctgtgtcctg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]