GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-11-01 08:35:19, GGRNA.v2 : RefSeq release 226 (Sep, 2024)

LOCUS       NM_001271454            2012 bp    mRNA    linear   ROD 30-MAR-2024
DEFINITION  Rattus norvegicus immunoglobin superfamily, member 21 (Igsf21),
            mRNA.
ACCESSION   NM_001271454 XM_003754110
VERSION     NM_001271454.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 2012)
  AUTHORS   Tanabe,Y., Naito,Y., Vasuta,C., Lee,A.K., Soumounou,Y.,
            Linhoff,M.W. and Takahashi,H.
  TITLE     IgSF21 promotes differentiation of inhibitory synapses via binding
            to neurexin2alpha
  JOURNAL   Nat Commun 8 (1), 408 (2017)
   PUBMED   28864826
  REMARK    Publication Status: Online-Only
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JAXUCZ010000005.1.
            
            On Feb 11, 2021 this sequence version replaced NM_001271454.1.
            
            Sequence Note: The RefSeq transcript and protein were derived from
            genomic sequence to make the sequence consistent with the reference
            genome assembly. The genomic coordinates used for the transcript
            record were based on alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: SRR22399481.2250465.1,
                                           SRR22399481.805834.1 [ECO:0000332]
            RNAseq introns              :: mixed sample support SAMEA5760383,
                                           SAMEA5760389 [ECO:0006172]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression,
                                      longest protein
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-522               JAXUCZ010000005.1  157794769-157795290 c
            523-635             JAXUCZ010000005.1  157702997-157703109 c
            636-757             JAXUCZ010000005.1  157651424-157651545 c
            758-876             JAXUCZ010000005.1  157611087-157611205 c
            877-992             JAXUCZ010000005.1  157581618-157581733 c
            993-1467            JAXUCZ010000005.1  157578614-157579088 c
            1468-1553           JAXUCZ010000005.1  157572873-157572958 c
            1554-1746           JAXUCZ010000005.1  157572212-157572404 c
            1747-1785           JAXUCZ010000005.1  157571846-157571884 c
            1786-2012           JAXUCZ010000005.1  157570964-157571190 c
FEATURES             Location/Qualifiers
     source          1..2012
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="5"
                     /map="5q36"
     gene            1..2012
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /note="immunoglobin superfamily, member 21"
                     /db_xref="GeneID:298591"
                     /db_xref="RGD:1310117"
     exon            1..522
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    354..356
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /note="upstream in-frame stop codon"
     CDS             453..1859
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /note="immunoglobulin superfamily member 21"
                     /codon_start=1
                     /product="immunoglobulin superfamily member 21 precursor"
                     /protein_id="NP_001258383.1"
                     /db_xref="GeneID:298591"
                     /db_xref="RGD:1310117"
                     /translation="
MRAAPSLRRASCLLLAAILDLARGYLTVNIEPLPPVVAGDAVTLKCNFKTDGRMREIVWYRVTDGGTIKQKIFTFDAMFSTNYSHMENYRKREDLVYQSTVRLPEVRISDNGPYECHVGIYDRATREKVVLASGNIFLNVMAPPTSIEVVAADSPAPFSRYQAQNFTLVCIVSGGKPAPMVYFKRDGEPIDAVPLTELPASSSGSVQDSRPFRSLLHRDVDDTKMQKSLSLLDTEYRAGRPYTERPSRSLTQDPNLFVQPTTENIPETVVSREFPRWVHSAEPVYFLRHSRTPGSDGTVEVRALLTWTLNPQIDNEALFSCEVKHPALSMPMQAEVTLVAPKGPKIMMTPSRARVGDTVRILVHGFQNEVFPEPMFTWTRVGSRLLDGSAEFDGKELVLERVPAELNGSMYRCTAQNPLGSTDTHTRLIVFENPNIPRGTEDSRGSASGPTGVRLTLVLALTVILELT"
     sig_peptide     453..524
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /inference="COORDINATES: ab initio prediction:SignalP:6.0"
     mat_peptide     525..1856
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /product="Immunoglobulin superfamily member 21.
                     /id=PRO_0000444205"
                     /note="propagated from UniProtKB/Swiss-Prot (M0RAS4.3)"
     misc_feature    540..842
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    576..590
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /note="Ig strand B [structural motif]; Region: Ig strand
                     B"
                     /db_xref="CDD:409353"
     misc_feature    618..632
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    750..761
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    789..806
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    819..830
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     misc_feature    <1566..1748
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:472250"
     misc_feature    1575..1589
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /note="Ig strand C [structural motif]; Region: Ig strand
                     C"
                     /db_xref="CDD:409353"
     misc_feature    1635..1649
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /note="Ig strand E [structural motif]; Region: Ig strand
                     E"
                     /db_xref="CDD:409353"
     misc_feature    1677..1697
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /note="Ig strand F [structural motif]; Region: Ig strand
                     F"
                     /db_xref="CDD:409353"
     misc_feature    1722..1733
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /note="Ig strand G [structural motif]; Region: Ig strand
                     G"
                     /db_xref="CDD:409353"
     exon            523..635
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /inference="alignment:Splign:2.1.0"
     exon            636..757
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /inference="alignment:Splign:2.1.0"
     exon            758..876
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /inference="alignment:Splign:2.1.0"
     exon            877..992
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /inference="alignment:Splign:2.1.0"
     exon            993..1467
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /inference="alignment:Splign:2.1.0"
     exon            1468..1553
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /inference="alignment:Splign:2.1.0"
     exon            1554..1746
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /inference="alignment:Splign:2.1.0"
     exon            1747..1785
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /inference="alignment:Splign:2.1.0"
     exon            1786..2012
                     /gene="Igsf21"
                     /gene_synonym="RGD1310117"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gagcgcggggcagagcgcggcggcgcgggcagagcttcggctccaaactccgccgctgccgccacggatccgactccggccgccgtgggcgccaggagcagccgaccagccgagagcagctgcgctccccagccaggtcctgtgcagcccagagcagccagtgtgtctggtgcagcccggagcatcctagtacagctcagagtagcctggtggtgtatcccggagcatcccggtacagcccagagcagccccgggtagcctggcggcccgaccacggtagcatgaggacgtccccgcggcgcccctcgctgcccgtcaccgccacggccggcggcccgggtcataagcgcttctgagcccatggcgaggggacccaccgtcgccaccgcgatcgccgccgccgccgccgccgccgccgccgcctcggccagcgccgtcagctcctgggcaccatgcgagctgctccaagcctccgccgcgcctcctgcctgctgctcgccgcgatcctggacctggcgcgcggctacctgacagtgaacattgagccccttccccctgtggtggccggggatgcagtgaccctgaagtgcaacttcaagacagacggccgcatgcgtgagatcgtgtggtaccgggtgacagatggcggcaccatcaagcagaagatcttcaccttcgatgccatgttctccaccaactactcccacatggagaattaccgcaagagggaggatcttgtgtaccagtccactgtgaggctgcctgaggtccggatctcagacaatggtccctatgagtgccacgtggggatctacgaccgagccacgagggagaaggtggtcctcgcctcgggcaacatcttcctcaacgtcatggctcctcccacctccattgaagtcgtggctgccgactcccctgcccccttcagccggtaccaggcccagaacttcacactggtctgcatcgtgtcaggagggaagccagcacccatggtttatttcaaacgggatggggaaccgattgatgccgtgcccctgacagaactgccagcgtccagctctggctcggtccaggacagcaggcccttccgcagccttctgcatagagacgtggacgataccaaaatgcaaaagtcactatcccttctggacactgaataccgggctggacgtccctacacggagcgcccctcgcgcagcctgacccaggaccccaacctcttcgtgcagcccaccacggaaaacataccagagacagtggtgagccgagagttcccccgttgggtacacagtgccgagccggtctacttcctgcgccacagccgcaccccaggcagcgatggcacggtggaggtgcgggccctgctcacctggaccctcaacccgcagatcgacaatgaggccctcttcagctgtgaggtcaagcacccagcgctgtctatgcccatgcaggcggaggtcacgctggttgctcccaaaggacccaaaatcatgatgacgcccagcagagcccgggttggggatacagtgaggatcctagtccacggatttcagaatgaggtcttcccagaacccatgttcacgtggacgagagtgggcagccgcctcctggatgggagtgctgaatttgacgggaaggagcttgtactggagcgggtccctgctgagctcaacggctccatgtaccgctgcactgcccagaacccactgggctccactgatacacacactcggctcatcgtgttcgaaaacccaaatatcccaagaggaaccgaggactcccgtggttctgcttctggccccactggcgtccggctcaccctggtgcttgccctgacagtgatcctggagctgacgtgaagatgccgccccctcccgatgctccagcggcccggcatctctgcgatcgattttcatgtcttttctaaactatttccagtcttgttcttagtcttggcccatgtcttggcttcctcactgggtttaattaaacagacagaccgattttcccca
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]