LOCUS       NR_128704                 85 bp    RNA     linear   ROD 04-DEC-2021
DEFINITION  Rattus norvegicus microRNA 1b (Mir1b), microRNA.
ACCESSION   NR_128704
VERSION     NR_128704.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 85)
  AUTHORS   Li X, Yuan L, Wang J, Zhang Z, Fu S, Wang S and Li X.
  TITLE     MiR-1b up-regulation inhibits rat neuron proliferation and
            regeneration yet promotes apoptosis via targeting KLF7
  JOURNAL   Folia Neuropathol 59 (1), 67-80 (2021)
   PUBMED   33969678
  REMARK    GeneRIF: MiR-1b up-regulation inhibits rat neuron proliferation and
            regeneration yet promotes apoptosis via targeting KLF7.
REFERENCE   2  (bases 1 to 85)
  AUTHORS   McGahon MK, Yarham JM, Daly A, Guduric-Fuchs J, Ferguson LJ,
            Simpson DA and Collins A.
  TITLE     Distinctive profile of IsomiR expression and novel microRNAs in rat
            heart left ventricle
  JOURNAL   PLoS One 8 (6), e65809 (2013)
   PUBMED   23799049
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 85)
  AUTHORS   Garcia-Lopez J, Hourcade Jde D and Del Mazo J.
  TITLE     Reprogramming of microRNAs by adenosine-to-inosine editing and the
            selective elimination of edited microRNA precursors in mouse
            oocytes and preimplantation embryos
  JOURNAL   Nucleic Acids Res 41 (10), 5483-5493 (2013)
   PUBMED   23571754
REFERENCE   4  (bases 1 to 85)
  AUTHORS   Polikepahad S and Corry DB.
  TITLE     Profiling of T helper cell-derived small RNAs reveals unique
            antisense transcripts and differential association of miRNAs with
            argonaute proteins 1 and 2
  JOURNAL   Nucleic Acids Res 41 (2), 1164-1177 (2013)
   PUBMED   23185045
REFERENCE   5  (bases 1 to 85)
  AUTHORS   Qian L, Wythe JD, Liu J, Cartry J, Vogler G, Mohapatra B, Otway RT,
            Huang Y, King IN, Maillet M, Zheng Y, Crawley T, Taghli-Lamallem O,
            Semsarian C, Dunwoodie S, Winlaw D, Harvey RP, Fatkin D, Towbin JA,
            Molkentin JD, Srivastava D, Ocorr K, Bruneau BG and Bodmer R.
  TITLE     Tinman/Nkx2-5 acts via miR-1 and upstream of Cdc42 to regulate
            heart function across species
  JOURNAL   J Cell Biol 193 (7), 1181-1196 (2011)
   PUBMED   21690310
REFERENCE   6  (bases 1 to 85)
  AUTHORS   Tarantino C, Paolella G, Cozzuto L, Minopoli G, Pastore L, Parisi S
            and Russo T.
  TITLE     miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic
            stem cells
  JOURNAL   FASEB J 24 (9), 3255-3263 (2010)
   PUBMED   20439489
REFERENCE   7  (bases 1 to 85)
  AUTHORS   Ikeda S, He A, Kong SW, Lu J, Bejar R, Bodyak N, Lee KH, Ma Q, Kang
            PM, Golub TR and Pu WT.
  TITLE     MicroRNA-1 negatively regulates expression of the
            hypertrophy-associated calmodulin and Mef2a genes
  JOURNAL   Mol Cell Biol 29 (8), 2193-2204 (2009)
   PUBMED   19188439
REFERENCE   8  (bases 1 to 85)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
REFERENCE   9  (bases 1 to 85)
  AUTHORS   Mansfield JH, Harfe BD, Nissen R, Obenauer J, Srineel J, Chaudhuri
            A, Farzan-Kashani R, Zuker M, Pasquinelli AE, Ruvkun G, Sharp PA,
            Tabin CJ and McManus MT.
  TITLE     MicroRNA-responsive 'sensor' transgenes uncover Hox-like and other
            developmentally regulated patterns of vertebrate microRNA
            expression
  JOURNAL   Nat Genet 36 (10), 1079-1083 (2004)
   PUBMED   15361871
  REMARK    Erratum:[Nat Genet. 2004 Nov;36(11):1238]
REFERENCE   10 (bases 1 to 85)
  AUTHORS   Jakoby,W.B., Ketterer,B. and Mannervik,B.
  TITLE     Glutathione transferases: nomenclature
  JOURNAL   Biochem Pharmacol 33 (16), 2539-2540 (1984)
   PUBMED   6466370
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from JACYVU010000123.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-85                JACYVU010000123.1  3084850-3084934
FEATURES             Location/Qualifiers
     source          1..85
                     /organism="Rattus norvegicus"
                     /mol_type="transcribed RNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="3"
                     /map="3q43"
     gene            1..85
                     /gene="Mir1b"
                     /gene_synonym="rno-mir-1b"
                     /note="microRNA 1b"
                     /db_xref="GeneID:104796289"
                     /db_xref="miRBase:MI0031785"
                     /db_xref="RGD:9685084"
     precursor_RNA   1..85
                     /gene="Mir1b"
                     /gene_synonym="rno-mir-1b"
                     /product="microRNA 1b"
                     /db_xref="GeneID:104796289"
                     /db_xref="miRBase:MI0031785"
                     /db_xref="RGD:9685084"
     exon            1..85
                     /gene="Mir1b"
                     /gene_synonym="rno-mir-1b"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           52..73
                     /ncRNA_class="miRNA"
                     /gene="Mir1b"
                     /gene_synonym="rno-mir-1b"
                     /product="rno-miR-1b"
                     /db_xref="miRBase:MIMAT0037263"
                     /db_xref="GeneID:104796289"
                     /db_xref="miRBase:MI0031785"
                     /db_xref="RGD:9685084"
ORIGIN      

cctgcttgggacacatacttctttatatgcccatatggacctgctaagctatggaatgtaaagaagtatgtatttcaggctagga

//