ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-24 23:08:16, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_106672 76 bp RNA linear ROD 02-APR-2024
DEFINITION Rattus norvegicus small nucleolar RNA, H/ACA box 58 (Snora58),
microRNA.
ACCESSION NR_106672
VERSION NR_106672.1
KEYWORDS RefSeq.
SOURCE Rattus norvegicus (Norway rat)
ORGANISM Rattus norvegicus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Rattus.
REFERENCE 1 (bases 1 to 76)
AUTHORS Su,Z.J., Wang,X.Y., Zhou,C. and Chai,Z.
TITLE Down-regulation of miR-3068-3p enhances kcnip4-regulated A-type
potassium current to protect against glutamate-induced
excitotoxicity
JOURNAL J Neurochem 153 (5), 617-630 (2020)
PUBMED 31792968
REMARK GeneRIF: Down-regulation of miR-3068-3p enhances kcnip4-regulated
A-type potassium current to protect against glutamate-induced
excitotoxicity.
REFERENCE 2 (bases 1 to 76)
AUTHORS Polikepahad,S. and Corry,D.B.
TITLE Profiling of T helper cell-derived small RNAs reveals unique
antisense transcripts and differential association of miRNAs with
argonaute proteins 1 and 2
JOURNAL Nucleic Acids Res 41 (2), 1164-1177 (2013)
PUBMED 23185045
REFERENCE 3 (bases 1 to 76)
AUTHORS Clokie,S.J., Lau,P., Kim,H.H., Coon,S.L. and Klein,D.C.
TITLE MicroRNAs in the pineal gland: miR-483 regulates melatonin
synthesis by targeting arylalkylamine N-acetyltransferase
JOURNAL J Biol Chem 287 (30), 25312-25324 (2012)
PUBMED 22908386
REFERENCE 4 (bases 1 to 76)
AUTHORS Hullin-Matsuda,F., Tomishige,N., Sakai,S., Ishitsuka,R., Ishii,K.,
Makino,A., Greimel,P., Abe,M., Laviad,E.L., Lagarde,M., Vidal,H.,
Saito,T., Osada,H., Hanada,K., Futerman,A.H. and Kobayashi,T.
TITLE Limonoid compounds inhibit sphingomyelin biosynthesis by preventing
CERT protein-dependent extraction of ceramides from the endoplasmic
reticulum
JOURNAL J Biol Chem 287 (29), 24397-24411 (2012)
PUBMED 22605339
REFERENCE 5 (bases 1 to 76)
AUTHORS Meng,F., Hackenberg,M., Li,Z., Yan,J. and Chen,T.
TITLE Discovery of novel microRNAs in rat kidney using next generation
sequencing and microarray validation
JOURNAL PLoS One 7 (3), e34394 (2012)
PUBMED 22470567
REFERENCE 6 (bases 1 to 76)
AUTHORS Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
Enright,A.J.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from JAXUCZ010000006.1.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-76 JAXUCZ010000006.1 112811875-112811950 c
FEATURES Location/Qualifiers
source 1..76
/organism="Rattus norvegicus"
/mol_type="transcribed RNA"
/strain="BN"
/db_xref="taxon:10116"
/chromosome="6"
/map="6q31"
gene 1..76
/gene="Snora58"
/gene_synonym="Mir3068; rno-mir-3068"
/note="small nucleolar RNA, H/ACA box 58"
/db_xref="GeneID:102466146"
/db_xref="miRBase:MI0021534"
/db_xref="RGD:7489013"
precursor_RNA 1..76
/gene="Snora58"
/gene_synonym="Mir3068; rno-mir-3068"
/product="small nucleolar RNA, H/ACA box 58"
/db_xref="GeneID:102466146"
/db_xref="miRBase:MI0021534"
/db_xref="RGD:7489013"
exon 1..76
/gene="Snora58"
/gene_synonym="Mir3068; rno-mir-3068"
/inference="alignment:Splign:2.1.0"
ncRNA 9..33
/ncRNA_class="miRNA"
/gene="Snora58"
/gene_synonym="Mir3068; rno-mir-3068"
/product="rno-miR-3068-5p"
/db_xref="miRBase:MIMAT0024845"
/db_xref="GeneID:102466146"
/db_xref="miRBase:MI0021534"
/db_xref="RGD:7489013"
ncRNA 50..71
/ncRNA_class="miRNA"
/gene="Snora58"
/gene_synonym="Mir3068; rno-mir-3068"
/product="rno-miR-3068-3p"
/db_xref="miRBase:MIMAT0024846"
/db_xref="GeneID:102466146"
/db_xref="miRBase:MI0021534"
/db_xref="RGD:7489013"
ORIGIN
aagagtaattggagttcatgcaagttctaaccagtttaaccagtagctgggtgaattgcagtactccaacattctg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]