GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-24 23:08:16, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_106672                 76 bp    RNA     linear   ROD 02-APR-2024
DEFINITION  Rattus norvegicus small nucleolar RNA, H/ACA box 58 (Snora58),
            microRNA.
ACCESSION   NR_106672
VERSION     NR_106672.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 76)
  AUTHORS   Su,Z.J., Wang,X.Y., Zhou,C. and Chai,Z.
  TITLE     Down-regulation of miR-3068-3p enhances kcnip4-regulated A-type
            potassium current to protect against glutamate-induced
            excitotoxicity
  JOURNAL   J Neurochem 153 (5), 617-630 (2020)
   PUBMED   31792968
  REMARK    GeneRIF: Down-regulation of miR-3068-3p enhances kcnip4-regulated
            A-type potassium current to protect against glutamate-induced
            excitotoxicity.
REFERENCE   2  (bases 1 to 76)
  AUTHORS   Polikepahad,S. and Corry,D.B.
  TITLE     Profiling of T helper cell-derived small RNAs reveals unique
            antisense transcripts and differential association of miRNAs with
            argonaute proteins 1 and 2
  JOURNAL   Nucleic Acids Res 41 (2), 1164-1177 (2013)
   PUBMED   23185045
REFERENCE   3  (bases 1 to 76)
  AUTHORS   Clokie,S.J., Lau,P., Kim,H.H., Coon,S.L. and Klein,D.C.
  TITLE     MicroRNAs in the pineal gland: miR-483 regulates melatonin
            synthesis by targeting arylalkylamine N-acetyltransferase
  JOURNAL   J Biol Chem 287 (30), 25312-25324 (2012)
   PUBMED   22908386
REFERENCE   4  (bases 1 to 76)
  AUTHORS   Hullin-Matsuda,F., Tomishige,N., Sakai,S., Ishitsuka,R., Ishii,K.,
            Makino,A., Greimel,P., Abe,M., Laviad,E.L., Lagarde,M., Vidal,H.,
            Saito,T., Osada,H., Hanada,K., Futerman,A.H. and Kobayashi,T.
  TITLE     Limonoid compounds inhibit sphingomyelin biosynthesis by preventing
            CERT protein-dependent extraction of ceramides from the endoplasmic
            reticulum
  JOURNAL   J Biol Chem 287 (29), 24397-24411 (2012)
   PUBMED   22605339
REFERENCE   5  (bases 1 to 76)
  AUTHORS   Meng,F., Hackenberg,M., Li,Z., Yan,J. and Chen,T.
  TITLE     Discovery of novel microRNAs in rat kidney using next generation
            sequencing and microarray validation
  JOURNAL   PLoS One 7 (3), e34394 (2012)
   PUBMED   22470567
REFERENCE   6  (bases 1 to 76)
  AUTHORS   Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
            Enright,A.J.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from JAXUCZ010000006.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-76                JAXUCZ010000006.1  112811875-112811950 c
FEATURES             Location/Qualifiers
     source          1..76
                     /organism="Rattus norvegicus"
                     /mol_type="transcribed RNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="6"
                     /map="6q31"
     gene            1..76
                     /gene="Snora58"
                     /gene_synonym="Mir3068; rno-mir-3068"
                     /note="small nucleolar RNA, H/ACA box 58"
                     /db_xref="GeneID:102466146"
                     /db_xref="miRBase:MI0021534"
                     /db_xref="RGD:7489013"
     precursor_RNA   1..76
                     /gene="Snora58"
                     /gene_synonym="Mir3068; rno-mir-3068"
                     /product="small nucleolar RNA, H/ACA box 58"
                     /db_xref="GeneID:102466146"
                     /db_xref="miRBase:MI0021534"
                     /db_xref="RGD:7489013"
     exon            1..76
                     /gene="Snora58"
                     /gene_synonym="Mir3068; rno-mir-3068"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           9..33
                     /ncRNA_class="miRNA"
                     /gene="Snora58"
                     /gene_synonym="Mir3068; rno-mir-3068"
                     /product="rno-miR-3068-5p"
                     /db_xref="miRBase:MIMAT0024845"
                     /db_xref="GeneID:102466146"
                     /db_xref="miRBase:MI0021534"
                     /db_xref="RGD:7489013"
     ncRNA           50..71
                     /ncRNA_class="miRNA"
                     /gene="Snora58"
                     /gene_synonym="Mir3068; rno-mir-3068"
                     /product="rno-miR-3068-3p"
                     /db_xref="miRBase:MIMAT0024846"
                     /db_xref="GeneID:102466146"
                     /db_xref="miRBase:MI0021534"
                     /db_xref="RGD:7489013"
ORIGIN      
aagagtaattggagttcatgcaagttctaaccagtttaaccagtagctgggtgaattgcagtactccaacattctg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]