2025-09-16 21:54:32, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS NR_032300 81 bp RNA linear ROD 02-APR-2024 DEFINITION Rattus norvegicus microRNA 652 (Mir652), microRNA. ACCESSION NR_032300 VERSION NR_032300.1 KEYWORDS RefSeq. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 81) AUTHORS Zuo,M.L., Wang,A.P., Song,G.L. and Yang,Z.B. TITLE miR-652 protects rats from cerebral ischemia/reperfusion oxidative stress injury by directly targeting NOX2 JOURNAL Biomed Pharmacother 124, 109860 (2020) PUBMED 32000043 REMARK GeneRIF: miR-652 protects rats from cerebral ischemia/reperfusion oxidative stress injury by directly targeting NOX2. REFERENCE 2 (bases 1 to 81) AUTHORS Li,J., Hu,C., Han,L., Liu,L., Jing,W., Tang,W., Tian,W. and Long,J. TITLE MiR-154-5p regulates osteogenic differentiation of adipose-derived mesenchymal stem cells under tensile stress through the Wnt/PCP pathway by targeting Wnt11 JOURNAL Bone 78, 130-141 (2015) PUBMED 25959411 REFERENCE 3 (bases 1 to 81) AUTHORS Gu,Q.H., Yu,D., Hu,Z., Liu,X., Yang,Y., Luo,Y., Zhu,J. and Li,Z. TITLE miR-26a and miR-384-5p are required for LTP maintenance and spine enlargement JOURNAL Nat Commun 6, 6789 (2015) PUBMED 25858512 REMARK Publication Status: Online-Only REFERENCE 4 (bases 1 to 81) AUTHORS Zhang,Q., Liu,H., McGee,J., Walsh,E.J., Soukup,G.A. and He,D.Z. TITLE Identifying microRNAs involved in degeneration of the organ of corti during age-related hearing loss JOURNAL PLoS One 8 (4), e62786 (2013) PUBMED 23646144 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 81) AUTHORS Polikepahad,S. and Corry,D.B. TITLE Profiling of T helper cell-derived small RNAs reveals unique antisense transcripts and differential association of miRNAs with argonaute proteins 1 and 2 JOURNAL Nucleic Acids Res 41 (2), 1164-1177 (2013) PUBMED 23185045 REFERENCE 6 (bases 1 to 81) AUTHORS Medrano,S., Monteagudo,M.C., Sequeira-Lopez,M.L., Pentz,E.S. and Gomez,R.A. TITLE Two microRNAs, miR-330 and miR-125b-5p, mark the juxtaglomerular cell and balance its smooth muscle phenotype JOURNAL Am J Physiol Renal Physiol 302 (1), F29-F37 (2012) PUBMED 21993888 REFERENCE 7 (bases 1 to 81) AUTHORS Tarantino,C., Paolella,G., Cozzuto,L., Minopoli,G., Pastore,L., Parisi,S. and Russo,T. TITLE miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic stem cells JOURNAL FASEB J 24 (9), 3255-3263 (2010) PUBMED 20439489 REFERENCE 8 (bases 1 to 81) AUTHORS Linsen,S.E., de Wit,E., de Bruijn,E. and Cuppen,E. TITLE Small RNA expression and strain specificity in the rat JOURNAL BMC Genomics 11, 249 (2010) PUBMED 20403161 REMARK Publication Status: Online-Only REFERENCE 9 (bases 1 to 81) AUTHORS Landgraf,P., Rusu,M., Sheridan,R., Sewer,A., Iovino,N., Aravin,A., Pfeffer,S., Rice,A., Kamphorst,A.O., Landthaler,M., Lin,C., Socci,N.D., Hermida,L., Fulci,V., Chiaretti,S., Foa,R., Schliwka,J., Fuchs,U., Novosel,A., Muller,R.U., Schermer,B., Bissels,U., Inman,J., Phan,Q., Chien,M., Weir,D.B., Choksi,R., De Vita,G., Frezzetti,D., Trompeter,H.I., Hornung,V., Teng,G., Hartmann,G., Palkovits,M., Di Lauro,R., Wernet,P., Macino,G., Rogler,C.E., Nagle,J.W., Ju,J., Papavasiliou,F.N., Benzing,T., Lichter,P., Tam,W., Brownstein,M.J., Bosio,A., Borkhardt,A., Russo,J.J., Sander,C., Zavolan,M. and Tuschl,T. TITLE A mammalian microRNA expression atlas based on small RNA library sequencing JOURNAL Cell 129 (7), 1401-1414 (2007) PUBMED 17604727 REFERENCE 10 (bases 1 to 81) AUTHORS Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and Enright,A.J. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from JAXUCZ010000021.1. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-81 JAXUCZ010000021.1 111140079-111140159 FEATURES Location/Qualifiers source 1..81 /organism="Rattus norvegicus" /mol_type="transcribed RNA" /strain="BN" /db_xref="taxon:10116" /chromosome="X" /map="Xq33" gene 1..81 /gene="Mir652" /gene_synonym="rno-mir-652" /note="microRNA 652" /db_xref="GeneID:100314177" /db_xref="miRBase:MI0006169" /db_xref="RGD:2325439" precursor_RNA 1..81 /gene="Mir652" /gene_synonym="rno-mir-652" /product="microRNA 652" /db_xref="GeneID:100314177" /db_xref="miRBase:MI0006169" /db_xref="RGD:2325439" exon 1..81 /gene="Mir652" /gene_synonym="rno-mir-652" /inference="alignment:Splign:2.1.0" ncRNA 10..32 /ncRNA_class="miRNA" /gene="Mir652" /gene_synonym="rno-mir-652" /product="rno-miR-652-5p" /db_xref="miRBase:MIMAT0017321" /db_xref="GeneID:100314177" /db_xref="miRBase:MI0006169" /db_xref="RGD:2325439" ncRNA 51..71 /ncRNA_class="miRNA" /gene="Mir652" /gene_synonym="rno-mir-652" /product="rno-miR-652-3p" /db_xref="miRBase:MIMAT0005342" /db_xref="GeneID:100314177" /db_xref="miRBase:MI0006169" /db_xref="RGD:2325439" ORIGIN
atgcactgcacaaccctaggagggggtgccattcacatagactataattgaatggcgccactagggttgtgcagtgtacaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]