GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2025-10-19 23:01:13, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       NR_032300                 81 bp    RNA     linear   ROD 02-APR-2024
DEFINITION  Rattus norvegicus microRNA 652 (Mir652), microRNA.
ACCESSION   NR_032300
VERSION     NR_032300.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 81)
  AUTHORS   Zuo,M.L., Wang,A.P., Song,G.L. and Yang,Z.B.
  TITLE     miR-652 protects rats from cerebral ischemia/reperfusion oxidative
            stress injury by directly targeting NOX2
  JOURNAL   Biomed Pharmacother 124, 109860 (2020)
   PUBMED   32000043
  REMARK    GeneRIF: miR-652 protects rats from cerebral ischemia/reperfusion
            oxidative stress injury by directly targeting NOX2.
REFERENCE   2  (bases 1 to 81)
  AUTHORS   Li,J., Hu,C., Han,L., Liu,L., Jing,W., Tang,W., Tian,W. and Long,J.
  TITLE     MiR-154-5p regulates osteogenic differentiation of adipose-derived
            mesenchymal stem cells under tensile stress through the Wnt/PCP
            pathway by targeting Wnt11
  JOURNAL   Bone 78, 130-141 (2015)
   PUBMED   25959411
REFERENCE   3  (bases 1 to 81)
  AUTHORS   Gu,Q.H., Yu,D., Hu,Z., Liu,X., Yang,Y., Luo,Y., Zhu,J. and Li,Z.
  TITLE     miR-26a and miR-384-5p are required for LTP maintenance and spine
            enlargement
  JOURNAL   Nat Commun 6, 6789 (2015)
   PUBMED   25858512
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 81)
  AUTHORS   Zhang,Q., Liu,H., McGee,J., Walsh,E.J., Soukup,G.A. and He,D.Z.
  TITLE     Identifying microRNAs involved in degeneration of the organ of
            corti during age-related hearing loss
  JOURNAL   PLoS One 8 (4), e62786 (2013)
   PUBMED   23646144
  REMARK    Publication Status: Online-Only
REFERENCE   5  (bases 1 to 81)
  AUTHORS   Polikepahad,S. and Corry,D.B.
  TITLE     Profiling of T helper cell-derived small RNAs reveals unique
            antisense transcripts and differential association of miRNAs with
            argonaute proteins 1 and 2
  JOURNAL   Nucleic Acids Res 41 (2), 1164-1177 (2013)
   PUBMED   23185045
REFERENCE   6  (bases 1 to 81)
  AUTHORS   Medrano,S., Monteagudo,M.C., Sequeira-Lopez,M.L., Pentz,E.S. and
            Gomez,R.A.
  TITLE     Two microRNAs, miR-330 and miR-125b-5p, mark the juxtaglomerular
            cell and balance its smooth muscle phenotype
  JOURNAL   Am J Physiol Renal Physiol 302 (1), F29-F37 (2012)
   PUBMED   21993888
REFERENCE   7  (bases 1 to 81)
  AUTHORS   Tarantino,C., Paolella,G., Cozzuto,L., Minopoli,G., Pastore,L.,
            Parisi,S. and Russo,T.
  TITLE     miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic
            stem cells
  JOURNAL   FASEB J 24 (9), 3255-3263 (2010)
   PUBMED   20439489
REFERENCE   8  (bases 1 to 81)
  AUTHORS   Linsen,S.E., de Wit,E., de Bruijn,E. and Cuppen,E.
  TITLE     Small RNA expression and strain specificity in the rat
  JOURNAL   BMC Genomics 11, 249 (2010)
   PUBMED   20403161
  REMARK    Publication Status: Online-Only
REFERENCE   9  (bases 1 to 81)
  AUTHORS   Landgraf,P., Rusu,M., Sheridan,R., Sewer,A., Iovino,N., Aravin,A.,
            Pfeffer,S., Rice,A., Kamphorst,A.O., Landthaler,M., Lin,C.,
            Socci,N.D., Hermida,L., Fulci,V., Chiaretti,S., Foa,R.,
            Schliwka,J., Fuchs,U., Novosel,A., Muller,R.U., Schermer,B.,
            Bissels,U., Inman,J., Phan,Q., Chien,M., Weir,D.B., Choksi,R., De
            Vita,G., Frezzetti,D., Trompeter,H.I., Hornung,V., Teng,G.,
            Hartmann,G., Palkovits,M., Di Lauro,R., Wernet,P., Macino,G.,
            Rogler,C.E., Nagle,J.W., Ju,J., Papavasiliou,F.N., Benzing,T.,
            Lichter,P., Tam,W., Brownstein,M.J., Bosio,A., Borkhardt,A.,
            Russo,J.J., Sander,C., Zavolan,M. and Tuschl,T.
  TITLE     A mammalian microRNA expression atlas based on small RNA library
            sequencing
  JOURNAL   Cell 129 (7), 1401-1414 (2007)
   PUBMED   17604727
REFERENCE   10 (bases 1 to 81)
  AUTHORS   Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
            Enright,A.J.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from JAXUCZ010000021.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-81                JAXUCZ010000021.1  111140079-111140159
FEATURES             Location/Qualifiers
     source          1..81
                     /organism="Rattus norvegicus"
                     /mol_type="transcribed RNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="X"
                     /map="Xq33"
     gene            1..81
                     /gene="Mir652"
                     /gene_synonym="rno-mir-652"
                     /note="microRNA 652"
                     /db_xref="GeneID:100314177"
                     /db_xref="miRBase:MI0006169"
                     /db_xref="RGD:2325439"
     precursor_RNA   1..81
                     /gene="Mir652"
                     /gene_synonym="rno-mir-652"
                     /product="microRNA 652"
                     /db_xref="GeneID:100314177"
                     /db_xref="miRBase:MI0006169"
                     /db_xref="RGD:2325439"
     exon            1..81
                     /gene="Mir652"
                     /gene_synonym="rno-mir-652"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           10..32
                     /ncRNA_class="miRNA"
                     /gene="Mir652"
                     /gene_synonym="rno-mir-652"
                     /product="rno-miR-652-5p"
                     /db_xref="miRBase:MIMAT0017321"
                     /db_xref="GeneID:100314177"
                     /db_xref="miRBase:MI0006169"
                     /db_xref="RGD:2325439"
     ncRNA           51..71
                     /ncRNA_class="miRNA"
                     /gene="Mir652"
                     /gene_synonym="rno-mir-652"
                     /product="rno-miR-652-3p"
                     /db_xref="miRBase:MIMAT0005342"
                     /db_xref="GeneID:100314177"
                     /db_xref="miRBase:MI0006169"
                     /db_xref="RGD:2325439"
ORIGIN      
atgcactgcacaaccctaggagggggtgccattcacatagactataattgaatggcgccactagggttgtgcagtgtacaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]