ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-09-15 04:25:51, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_032284 80 bp RNA linear ROD 02-APR-2024
DEFINITION Rattus norvegicus microRNA 500 (Mir500), microRNA.
ACCESSION NR_032284
VERSION NR_032284.1
KEYWORDS RefSeq.
SOURCE Rattus norvegicus (Norway rat)
ORGANISM Rattus norvegicus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Rattus.
REFERENCE 1 (bases 1 to 80)
AUTHORS Huang,Z.Z., Wei,J.Y., Ou-Yang,H.D., Li,D., Xu,T., Wu,S.L.,
Zhang,X.L., Liu,C.C., Ma,C. and Xin,W.J.
TITLE mir-500-Mediated GAD67 Downregulation Contributes to Neuropathic
Pain
JOURNAL J Neurosci 36 (23), 6321-6331 (2016)
PUBMED 27277808
REMARK GeneRIF: The present study illustrates for the first time a
mir-500-mediated mechanism underlying spinal GABAergic dysfunction
and sensitized pain behavior in neuropathic pain induced by the
chemotherapeutic drug paclitaxel L5 ventral root transection.
REFERENCE 2 (bases 1 to 80)
AUTHORS Gu,Q.H., Yu,D., Hu,Z., Liu,X., Yang,Y., Luo,Y., Zhu,J. and Li,Z.
TITLE miR-26a and miR-384-5p are required for LTP maintenance and spine
enlargement
JOURNAL Nat Commun 6, 6789 (2015)
PUBMED 25858512
REMARK Publication Status: Online-Only
REFERENCE 3 (bases 1 to 80)
AUTHORS Polikepahad,S. and Corry,D.B.
TITLE Profiling of T helper cell-derived small RNAs reveals unique
antisense transcripts and differential association of miRNAs with
argonaute proteins 1 and 2
JOURNAL Nucleic Acids Res 41 (2), 1164-1177 (2013)
PUBMED 23185045
REFERENCE 4 (bases 1 to 80)
AUTHORS Mor,E., Cabilly,Y., Goldshmit,Y., Zalts,H., Modai,S., Edry,L.,
Elroy-Stein,O. and Shomron,N.
TITLE Species-specific microRNA roles elucidated following astrocyte
activation
JOURNAL Nucleic Acids Res 39 (9), 3710-3723 (2011)
PUBMED 21247879
REFERENCE 5 (bases 1 to 80)
AUTHORS Tarantino,C., Paolella,G., Cozzuto,L., Minopoli,G., Pastore,L.,
Parisi,S. and Russo,T.
TITLE miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic
stem cells
JOURNAL FASEB J 24 (9), 3255-3263 (2010)
PUBMED 20439489
REFERENCE 6 (bases 1 to 80)
AUTHORS Linsen,S.E., de Wit,E., de Bruijn,E. and Cuppen,E.
TITLE Small RNA expression and strain specificity in the rat
JOURNAL BMC Genomics 11, 249 (2010)
PUBMED 20403161
REMARK Publication Status: Online-Only
REFERENCE 7 (bases 1 to 80)
AUTHORS Landgraf,P., Rusu,M., Sheridan,R., Sewer,A., Iovino,N., Aravin,A.,
Pfeffer,S., Rice,A., Kamphorst,A.O., Landthaler,M., Lin,C.,
Socci,N.D., Hermida,L., Fulci,V., Chiaretti,S., Foa,R.,
Schliwka,J., Fuchs,U., Novosel,A., Muller,R.U., Schermer,B.,
Bissels,U., Inman,J., Phan,Q., Chien,M., Weir,D.B., Choksi,R., De
Vita,G., Frezzetti,D., Trompeter,H.I., Hornung,V., Teng,G.,
Hartmann,G., Palkovits,M., Di Lauro,R., Wernet,P., Macino,G.,
Rogler,C.E., Nagle,J.W., Ju,J., Papavasiliou,F.N., Benzing,T.,
Lichter,P., Tam,W., Brownstein,M.J., Bosio,A., Borkhardt,A.,
Russo,J.J., Sander,C., Zavolan,M. and Tuschl,T.
TITLE A mammalian microRNA expression atlas based on small RNA library
sequencing
JOURNAL Cell 129 (7), 1401-1414 (2007)
PUBMED 17604727
REFERENCE 8 (bases 1 to 80)
AUTHORS Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
Enright,A.J.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from JAXUCZ010000021.1.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-80 JAXUCZ010000021.1 17930647-17930726
FEATURES Location/Qualifiers
source 1..80
/organism="Rattus norvegicus"
/mol_type="transcribed RNA"
/strain="BN"
/db_xref="taxon:10116"
/chromosome="X"
/map="Xq12"
gene 1..80
/gene="Mir500"
/gene_synonym="rno-mir-500"
/note="microRNA 500"
/db_xref="GeneID:100314112"
/db_xref="miRBase:MI0006153"
/db_xref="RGD:2325495"
precursor_RNA 1..80
/gene="Mir500"
/gene_synonym="rno-mir-500"
/product="microRNA 500"
/db_xref="GeneID:100314112"
/db_xref="miRBase:MI0006153"
/db_xref="RGD:2325495"
exon 1..80
/gene="Mir500"
/gene_synonym="rno-mir-500"
/inference="alignment:Splign:2.1.0"
ncRNA 11..34
/ncRNA_class="miRNA"
/gene="Mir500"
/gene_synonym="rno-mir-500"
/product="rno-miR-500-5p"
/db_xref="miRBase:MIMAT0017311"
/db_xref="GeneID:100314112"
/db_xref="miRBase:MI0006153"
/db_xref="RGD:2325495"
ncRNA 49..70
/ncRNA_class="miRNA"
/gene="Mir500"
/gene_synonym="rno-mir-500"
/product="rno-miR-500-3p"
/db_xref="miRBase:MIMAT0005321"
/db_xref="GeneID:100314112"
/db_xref="miRBase:MI0006153"
/db_xref="RGD:2325495"
ORIGIN
ccccctctctaatccttgctatctgggtgcttagtgctatctcaatgcaatgcacctgggcaagggttcagagaaggtga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]