GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-15 04:25:51, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_032284                 80 bp    RNA     linear   ROD 02-APR-2024
DEFINITION  Rattus norvegicus microRNA 500 (Mir500), microRNA.
ACCESSION   NR_032284
VERSION     NR_032284.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 80)
  AUTHORS   Huang,Z.Z., Wei,J.Y., Ou-Yang,H.D., Li,D., Xu,T., Wu,S.L.,
            Zhang,X.L., Liu,C.C., Ma,C. and Xin,W.J.
  TITLE     mir-500-Mediated GAD67 Downregulation Contributes to Neuropathic
            Pain
  JOURNAL   J Neurosci 36 (23), 6321-6331 (2016)
   PUBMED   27277808
  REMARK    GeneRIF: The present study illustrates for the first time a
            mir-500-mediated mechanism underlying spinal GABAergic dysfunction
            and sensitized pain behavior in neuropathic pain induced by the
            chemotherapeutic drug paclitaxel L5 ventral root transection.
REFERENCE   2  (bases 1 to 80)
  AUTHORS   Gu,Q.H., Yu,D., Hu,Z., Liu,X., Yang,Y., Luo,Y., Zhu,J. and Li,Z.
  TITLE     miR-26a and miR-384-5p are required for LTP maintenance and spine
            enlargement
  JOURNAL   Nat Commun 6, 6789 (2015)
   PUBMED   25858512
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 80)
  AUTHORS   Polikepahad,S. and Corry,D.B.
  TITLE     Profiling of T helper cell-derived small RNAs reveals unique
            antisense transcripts and differential association of miRNAs with
            argonaute proteins 1 and 2
  JOURNAL   Nucleic Acids Res 41 (2), 1164-1177 (2013)
   PUBMED   23185045
REFERENCE   4  (bases 1 to 80)
  AUTHORS   Mor,E., Cabilly,Y., Goldshmit,Y., Zalts,H., Modai,S., Edry,L.,
            Elroy-Stein,O. and Shomron,N.
  TITLE     Species-specific microRNA roles elucidated following astrocyte
            activation
  JOURNAL   Nucleic Acids Res 39 (9), 3710-3723 (2011)
   PUBMED   21247879
REFERENCE   5  (bases 1 to 80)
  AUTHORS   Tarantino,C., Paolella,G., Cozzuto,L., Minopoli,G., Pastore,L.,
            Parisi,S. and Russo,T.
  TITLE     miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic
            stem cells
  JOURNAL   FASEB J 24 (9), 3255-3263 (2010)
   PUBMED   20439489
REFERENCE   6  (bases 1 to 80)
  AUTHORS   Linsen,S.E., de Wit,E., de Bruijn,E. and Cuppen,E.
  TITLE     Small RNA expression and strain specificity in the rat
  JOURNAL   BMC Genomics 11, 249 (2010)
   PUBMED   20403161
  REMARK    Publication Status: Online-Only
REFERENCE   7  (bases 1 to 80)
  AUTHORS   Landgraf,P., Rusu,M., Sheridan,R., Sewer,A., Iovino,N., Aravin,A.,
            Pfeffer,S., Rice,A., Kamphorst,A.O., Landthaler,M., Lin,C.,
            Socci,N.D., Hermida,L., Fulci,V., Chiaretti,S., Foa,R.,
            Schliwka,J., Fuchs,U., Novosel,A., Muller,R.U., Schermer,B.,
            Bissels,U., Inman,J., Phan,Q., Chien,M., Weir,D.B., Choksi,R., De
            Vita,G., Frezzetti,D., Trompeter,H.I., Hornung,V., Teng,G.,
            Hartmann,G., Palkovits,M., Di Lauro,R., Wernet,P., Macino,G.,
            Rogler,C.E., Nagle,J.W., Ju,J., Papavasiliou,F.N., Benzing,T.,
            Lichter,P., Tam,W., Brownstein,M.J., Bosio,A., Borkhardt,A.,
            Russo,J.J., Sander,C., Zavolan,M. and Tuschl,T.
  TITLE     A mammalian microRNA expression atlas based on small RNA library
            sequencing
  JOURNAL   Cell 129 (7), 1401-1414 (2007)
   PUBMED   17604727
REFERENCE   8  (bases 1 to 80)
  AUTHORS   Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
            Enright,A.J.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from JAXUCZ010000021.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-80                JAXUCZ010000021.1  17930647-17930726
FEATURES             Location/Qualifiers
     source          1..80
                     /organism="Rattus norvegicus"
                     /mol_type="transcribed RNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="X"
                     /map="Xq12"
     gene            1..80
                     /gene="Mir500"
                     /gene_synonym="rno-mir-500"
                     /note="microRNA 500"
                     /db_xref="GeneID:100314112"
                     /db_xref="miRBase:MI0006153"
                     /db_xref="RGD:2325495"
     precursor_RNA   1..80
                     /gene="Mir500"
                     /gene_synonym="rno-mir-500"
                     /product="microRNA 500"
                     /db_xref="GeneID:100314112"
                     /db_xref="miRBase:MI0006153"
                     /db_xref="RGD:2325495"
     exon            1..80
                     /gene="Mir500"
                     /gene_synonym="rno-mir-500"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           11..34
                     /ncRNA_class="miRNA"
                     /gene="Mir500"
                     /gene_synonym="rno-mir-500"
                     /product="rno-miR-500-5p"
                     /db_xref="miRBase:MIMAT0017311"
                     /db_xref="GeneID:100314112"
                     /db_xref="miRBase:MI0006153"
                     /db_xref="RGD:2325495"
     ncRNA           49..70
                     /ncRNA_class="miRNA"
                     /gene="Mir500"
                     /gene_synonym="rno-mir-500"
                     /product="rno-miR-500-3p"
                     /db_xref="miRBase:MIMAT0005321"
                     /db_xref="GeneID:100314112"
                     /db_xref="miRBase:MI0006153"
                     /db_xref="RGD:2325495"
ORIGIN      
ccccctctctaatccttgctatctgggtgcttagtgctatctcaatgcaatgcacctgggcaagggttcagagaaggtga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]