GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-29 15:45:05, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NR_032109                 70 bp    RNA     linear   ROD 24-MAY-2022
DEFINITION  Rattus norvegicus microRNA 361 (Mir361), microRNA.
ACCESSION   NR_032109
VERSION     NR_032109.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 70)
  AUTHORS   Zhang J, Zhou X, Sun J, Li M, Ma J and Ge L.
  TITLE     miR-361-3p mitigates hypoxia-induced cardiomyocyte injury via
            targeting apoptosis initiators caspase-2/-8/-9
  JOURNAL   In Vitro Cell Dev Biol Anim 58 (2), 116-123 (2022)
   PUBMED   35165827
  REMARK    GeneRIF: miR-361-3p mitigates hypoxia-induced cardiomyocyte injury
            via targeting apoptosis initiators caspase-2/-8/-9.
REFERENCE   2  (bases 1 to 70)
  AUTHORS   Zeng T, Zhang S, He Y, Liu Z and Cheng Q.
  TITLE     MiR-361-5p promotes oxygen-glucose deprivation/re-oxygenation
            induced neuronal injury by negatively regulating SQSTM1 in vitro
  JOURNAL   Metab Brain Dis 36 (8), 2359-2368 (2021)
   PUBMED   34581931
  REMARK    GeneRIF: MiR-361-5p promotes oxygen-glucose
            deprivation/re-oxygenation induced neuronal injury by negatively
            regulating SQSTM1 in vitro.
REFERENCE   3  (bases 1 to 70)
  AUTHORS   Zhang Q, Liu H, McGee J, Walsh EJ, Soukup GA and He DZ.
  TITLE     Identifying microRNAs involved in degeneration of the organ of
            corti during age-related hearing loss
  JOURNAL   PLoS One 8 (4), e62786 (2013)
   PUBMED   23646144
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 70)
  AUTHORS   Polikepahad S and Corry DB.
  TITLE     Profiling of T helper cell-derived small RNAs reveals unique
            antisense transcripts and differential association of miRNAs with
            argonaute proteins 1 and 2
  JOURNAL   Nucleic Acids Res 41 (2), 1164-1177 (2013)
   PUBMED   23185045
REFERENCE   5  (bases 1 to 70)
  AUTHORS   Linsen SE, de Wit E, de Bruijn E and Cuppen E.
  TITLE     Small RNA expression and strain specificity in the rat
  JOURNAL   BMC Genomics 11, 249 (2010)
   PUBMED   20403161
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 70)
  AUTHORS   Ye W, Lv Q, Wong CK, Hu S, Fu C, Hua Z, Cai G, Li G, Yang BB and
            Zhang Y.
  TITLE     The effect of central loops in miRNA:MRE duplexes on the efficiency
            of miRNA-mediated gene regulation
  JOURNAL   PLoS One 3 (3), e1719 (2008)
   PUBMED   18320040
  REMARK    Publication Status: Online-Only
REFERENCE   7  (bases 1 to 70)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
REFERENCE   8  (bases 1 to 70)
  AUTHORS   Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ,
            Tuschl T, van Nimwegen E and Zavolan M.
  TITLE     Identification of clustered microRNAs using an ab initio prediction
            method
  JOURNAL   BMC Bioinformatics 6, 267 (2005)
   PUBMED   16274478
  REMARK    Publication Status: Online-Only
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from JACYVU010000431.1.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-70                JACYVU010000431.1  1266492-1266561     c
FEATURES             Location/Qualifiers
     source          1..70
                     /organism="Rattus norvegicus"
                     /mol_type="transcribed RNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="X"
                     /map="Xq31"
     gene            1..70
                     /gene="Mir361"
                     /gene_synonym="rno-mir-361"
                     /note="microRNA 361"
                     /db_xref="GeneID:100314073"
                     /db_xref="miRBase:MI0003481"
                     /db_xref="RGD:2325532"
     precursor_RNA   1..70
                     /gene="Mir361"
                     /gene_synonym="rno-mir-361"
                     /product="microRNA 361"
                     /db_xref="GeneID:100314073"
                     /db_xref="miRBase:MI0003481"
                     /db_xref="RGD:2325532"
     exon            1..70
                     /gene="Mir361"
                     /gene_synonym="rno-mir-361"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           6..27
                     /ncRNA_class="miRNA"
                     /gene="Mir361"
                     /gene_synonym="rno-mir-361"
                     /product="rno-miR-361-5p"
                     /db_xref="miRBase:MIMAT0003117"
                     /db_xref="GeneID:100314073"
                     /db_xref="miRBase:MI0003481"
                     /db_xref="RGD:2325532"
     ncRNA           44..67
                     /ncRNA_class="miRNA"
                     /gene="Mir361"
                     /gene_synonym="rno-mir-361"
                     /product="rno-miR-361-3p"
                     /db_xref="miRBase:MIMAT0017199"
                     /db_xref="GeneID:100314073"
                     /db_xref="miRBase:MI0003481"
                     /db_xref="RGD:2325532"
ORIGIN      
gaagcttatcagaatctccaggggtacttattatttgaaaagtcccccaggtgtgattctgattcgtttc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]