2024-04-29 15:45:05, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_032109 70 bp RNA linear ROD 24-MAY-2022 DEFINITION Rattus norvegicus microRNA 361 (Mir361), microRNA. ACCESSION NR_032109 VERSION NR_032109.1 KEYWORDS RefSeq. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 70) AUTHORS Zhang J, Zhou X, Sun J, Li M, Ma J and Ge L. TITLE miR-361-3p mitigates hypoxia-induced cardiomyocyte injury via targeting apoptosis initiators caspase-2/-8/-9 JOURNAL In Vitro Cell Dev Biol Anim 58 (2), 116-123 (2022) PUBMED 35165827 REMARK GeneRIF: miR-361-3p mitigates hypoxia-induced cardiomyocyte injury via targeting apoptosis initiators caspase-2/-8/-9. REFERENCE 2 (bases 1 to 70) AUTHORS Zeng T, Zhang S, He Y, Liu Z and Cheng Q. TITLE MiR-361-5p promotes oxygen-glucose deprivation/re-oxygenation induced neuronal injury by negatively regulating SQSTM1 in vitro JOURNAL Metab Brain Dis 36 (8), 2359-2368 (2021) PUBMED 34581931 REMARK GeneRIF: MiR-361-5p promotes oxygen-glucose deprivation/re-oxygenation induced neuronal injury by negatively regulating SQSTM1 in vitro. REFERENCE 3 (bases 1 to 70) AUTHORS Zhang Q, Liu H, McGee J, Walsh EJ, Soukup GA and He DZ. TITLE Identifying microRNAs involved in degeneration of the organ of corti during age-related hearing loss JOURNAL PLoS One 8 (4), e62786 (2013) PUBMED 23646144 REMARK Publication Status: Online-Only REFERENCE 4 (bases 1 to 70) AUTHORS Polikepahad S and Corry DB. TITLE Profiling of T helper cell-derived small RNAs reveals unique antisense transcripts and differential association of miRNAs with argonaute proteins 1 and 2 JOURNAL Nucleic Acids Res 41 (2), 1164-1177 (2013) PUBMED 23185045 REFERENCE 5 (bases 1 to 70) AUTHORS Linsen SE, de Wit E, de Bruijn E and Cuppen E. TITLE Small RNA expression and strain specificity in the rat JOURNAL BMC Genomics 11, 249 (2010) PUBMED 20403161 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 70) AUTHORS Ye W, Lv Q, Wong CK, Hu S, Fu C, Hua Z, Cai G, Li G, Yang BB and Zhang Y. TITLE The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation JOURNAL PLoS One 3 (3), e1719 (2008) PUBMED 18320040 REMARK Publication Status: Online-Only REFERENCE 7 (bases 1 to 70) AUTHORS Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright AJ. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 REFERENCE 8 (bases 1 to 70) AUTHORS Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E and Zavolan M. TITLE Identification of clustered microRNAs using an ab initio prediction method JOURNAL BMC Bioinformatics 6, 267 (2005) PUBMED 16274478 REMARK Publication Status: Online-Only COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from JACYVU010000431.1. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-70 JACYVU010000431.1 1266492-1266561 c FEATURES Location/Qualifiers source 1..70 /organism="Rattus norvegicus" /mol_type="transcribed RNA" /strain="BN" /db_xref="taxon:10116" /chromosome="X" /map="Xq31" gene 1..70 /gene="Mir361" /gene_synonym="rno-mir-361" /note="microRNA 361" /db_xref="GeneID:100314073" /db_xref="miRBase:MI0003481" /db_xref="RGD:2325532" precursor_RNA 1..70 /gene="Mir361" /gene_synonym="rno-mir-361" /product="microRNA 361" /db_xref="GeneID:100314073" /db_xref="miRBase:MI0003481" /db_xref="RGD:2325532" exon 1..70 /gene="Mir361" /gene_synonym="rno-mir-361" /inference="alignment:Splign:2.1.0" ncRNA 6..27 /ncRNA_class="miRNA" /gene="Mir361" /gene_synonym="rno-mir-361" /product="rno-miR-361-5p" /db_xref="miRBase:MIMAT0003117" /db_xref="GeneID:100314073" /db_xref="miRBase:MI0003481" /db_xref="RGD:2325532" ncRNA 44..67 /ncRNA_class="miRNA" /gene="Mir361" /gene_synonym="rno-mir-361" /product="rno-miR-361-3p" /db_xref="miRBase:MIMAT0017199" /db_xref="GeneID:100314073" /db_xref="miRBase:MI0003481" /db_xref="RGD:2325532" ORIGIN
gaagcttatcagaatctccaggggtacttattatttgaaaagtcccccaggtgtgattctgattcgtttc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]