2025-07-07 06:03:38, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NR_031942 82 bp RNA linear ROD 02-APR-2024 DEFINITION Rattus norvegicus microRNA 298 (Mir298), microRNA. ACCESSION NR_031942 VERSION NR_031942.1 KEYWORDS RefSeq. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 82) AUTHORS Liu,L., Li,J., Wang,R., Wang,Y. and Wang,G. TITLE MicroRNA-298 Exacerbates Myocardial Ischemic Injury via Targeting Cyclin D1 JOURNAL Pharmazie 74 (6), 369-373 (2019) PUBMED 31138376 REMARK GeneRIF: Overexpression of miR-298 may exacerbate myocardial ischemic injury by targeting cyclin D1 and regulating the activation of PTEN/PI3K/AKT signaling pathway. REFERENCE 2 (bases 1 to 82) AUTHORS Zhang,Q., Yu,N. and Yu,B.T. TITLE MicroRNA-298 regulates apoptosis of cardiomyocytes after myocardial infarction JOURNAL Eur Rev Med Pharmacol Sci 22 (2), 532-539 (2018) PUBMED 29424914 REMARK GeneRIF: The up-regulation of miR-298 significantly improved the cardiac function, decreased the expressions of BAX, reduced the myocardial apoptosis and inhibit the apoptosis proteins expression including cytochrome-c and cleaved caspase-3. REFERENCE 3 (bases 1 to 82) AUTHORS Zhang,Q., Liu,H., McGee,J., Walsh,E.J., Soukup,G.A. and He,D.Z. TITLE Identifying microRNAs involved in degeneration of the organ of corti during age-related hearing loss JOURNAL PLoS One 8 (4), e62786 (2013) PUBMED 23646144 REMARK Publication Status: Online-Only REFERENCE 4 (bases 1 to 82) AUTHORS Polikepahad,S. and Corry,D.B. TITLE Profiling of T helper cell-derived small RNAs reveals unique antisense transcripts and differential association of miRNAs with argonaute proteins 1 and 2 JOURNAL Nucleic Acids Res 41 (2), 1164-1177 (2013) PUBMED 23185045 REFERENCE 5 (bases 1 to 82) AUTHORS Chew,W.S., Poh,K.W., Siddiqi,N.J., Alhomida,A.S., Yu,L.E. and Ong,W.Y. TITLE Short- and long-term changes in blood miRNA levels after nanogold injection in rats--potential biomarkers of nanoparticle exposure JOURNAL Biomarkers 17 (8), 750-757 (2012) PUBMED 23030236 REMARK GeneRIF: Data indicate that rno-miR-298 was confirmed to be increased at 1 week postinjection of gold nanoparticle (AuNP). REFERENCE 6 (bases 1 to 82) AUTHORS Tarantino,C., Paolella,G., Cozzuto,L., Minopoli,G., Pastore,L., Parisi,S. and Russo,T. TITLE miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic stem cells JOURNAL FASEB J 24 (9), 3255-3263 (2010) PUBMED 20439489 REFERENCE 7 (bases 1 to 82) AUTHORS Linsen,S.E., de Wit,E., de Bruijn,E. and Cuppen,E. TITLE Small RNA expression and strain specificity in the rat JOURNAL BMC Genomics 11, 249 (2010) PUBMED 20403161 REMARK Publication Status: Online-Only REFERENCE 8 (bases 1 to 82) AUTHORS Landgraf,P., Rusu,M., Sheridan,R., Sewer,A., Iovino,N., Aravin,A., Pfeffer,S., Rice,A., Kamphorst,A.O., Landthaler,M., Lin,C., Socci,N.D., Hermida,L., Fulci,V., Chiaretti,S., Foa,R., Schliwka,J., Fuchs,U., Novosel,A., Muller,R.U., Schermer,B., Bissels,U., Inman,J., Phan,Q., Chien,M., Weir,D.B., Choksi,R., De Vita,G., Frezzetti,D., Trompeter,H.I., Hornung,V., Teng,G., Hartmann,G., Palkovits,M., Di Lauro,R., Wernet,P., Macino,G., Rogler,C.E., Nagle,J.W., Ju,J., Papavasiliou,F.N., Benzing,T., Lichter,P., Tam,W., Brownstein,M.J., Bosio,A., Borkhardt,A., Russo,J.J., Sander,C., Zavolan,M. and Tuschl,T. TITLE A mammalian microRNA expression atlas based on small RNA library sequencing JOURNAL Cell 129 (7), 1401-1414 (2007) PUBMED 17604727 REFERENCE 9 (bases 1 to 82) AUTHORS Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and Enright,A.J. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from JAXUCZ010000003.1. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-82 JAXUCZ010000003.1 183470522-183470603 c FEATURES Location/Qualifiers source 1..82 /organism="Rattus norvegicus" /mol_type="transcribed RNA" /strain="BN" /db_xref="taxon:10116" /chromosome="3" /map="3q43" gene 1..82 /gene="Mir298" /gene_synonym="rno-mir-298" /note="microRNA 298" /db_xref="GeneID:100314250" /db_xref="miRBase:MI0000969" /db_xref="RGD:2325373" precursor_RNA 1..82 /gene="Mir298" /gene_synonym="rno-mir-298" /product="microRNA 298" /db_xref="GeneID:100314250" /db_xref="miRBase:MI0000969" /db_xref="RGD:2325373" exon 1..82 /gene="Mir298" /gene_synonym="rno-mir-298" /inference="alignment:Splign:2.1.0" ncRNA 11..33 /ncRNA_class="miRNA" /gene="Mir298" /gene_synonym="rno-mir-298" /product="rno-miR-298-5p" /db_xref="miRBase:MIMAT0000900" /db_xref="GeneID:100314250" /db_xref="miRBase:MI0000969" /db_xref="RGD:2325373" ncRNA 52..73 /ncRNA_class="miRNA" /gene="Mir298" /gene_synonym="rno-mir-298" /product="rno-miR-298-3p" /db_xref="miRBase:MIMAT0017166" /db_xref="GeneID:100314250" /db_xref="miRBase:MI0000969" /db_xref="RGD:2325373" ORIGIN
ccaggccttcggcagaggagggctgttcttcccttgggttttatgactgggaggaactagccttctctctgcttaggagtgg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]